Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SNX3
Systematic Name YOR357C
Alias GRD19
Description Sorting nexin required to maintain late-Golgi resident enzymes in their proper location by recycling molecules from the prevacuolar compartment; contains a PX domain and sequence similarity to human Snx3p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GRD19	6324933 upstream sequence, from -1000 to -1, size 1000
GATGGGGGCCTCTGCACTAATCATCTTGACATCTTCATCCGTCTTCATGACCTTGCGGAT
TCTCGCAAATGGTAAGGAATGTGATTTGAAGTCATCTTGATGCTCGGAACCAGGTTCATT
CGTAGACTCGATCTCGTTGATTAATTCTTGCCAATAACGGATCATTATCTCCTTGTAGTG
GCCCACCAATCCCTGACCAACGTTCCTAAACACATCATACTCTTCATCGTCCTCGTCCAT
TTCTCCGTCTGCGCCGTCGCTGTTTCCATTATCTTCGCCTTCAAGCGATCCTCGACCACT
TGGCGGTAGATTAGCTTGGTCATGGCCCGCCTGGATAGCTTGCAACTCCTGTACCATCCG
GAACTCTTCCTCAGAAACAGGTAGCCTCGTATTTTCCCCTTCCCCTTCGTTTTCTTGCAG
TTGTTGCTGTTCTGAATATTGCCTTGGCATATTCATTTCCTCTCTCTGAATCATCGTACT
GGGTTGCGGTCCCTCCGGGAGCGATTCTTGAGGTCCTTGTCCTTGTTGTGGTGAGAAATT
CCTATCAGTCATTATGCGAGTAAACAATCCTGATGCTGCAAATGCGTCACAACTCTTACA
TTATCTCCTATTCCCCTCTATTCTTCTTCTTTGCTTACGCGGTATTATAGCAGCTAAGGA
AGCTTAATCTCCGGAAGCAATCTTAAGGGAGCCGTCCCACGCAAATTTAAGTTTAACTAC
GGAAAAGGGAGCACAACACTCTTCGATTTTGACATTTCGGGATTTCTACACTCTAGTAAG
TATTGCGCTAGGAGGGACCATGATTTACTATGAGGACTTGGCTATGGGGTGCTCAGAATT
GCATAAGTGAACTCGAGGATAGCTTTGGGCACTATCACGTACTAAGTGATATGTATTGAT
ATGTAAACCTGCAATGAATGAATGGATTAAAACGGATCTTAATACTGCATAAAAGAGGAC
GGCAAGAACAGCTGAGAAGCGGTACGCATCTACACAAAGT
Chromosomal Coordinates Chr XV from 1009712-1009224
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator