Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MKK1
Systematic Name YOR231W
Alias SSP32
Description Mitogen-activated kinase kinase involved in protein kinase C signaling pathway that controls cell integrity; upon activation by Bck1p phosphorylates downstream target, Slt2p; functionally redundant with Mkk2p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MKK1	6324805 upstream sequence, from -1000 to -1, size 1000
AAATTGACCTCGTTTGATTGCTCTCAGGTTTCCAACAACTTGTTTGTTACCGGTTTCAGT
ACGGGTATTATCAAGTTATGGGATGCCAGAGCGGCTGAAGCTGCCACCACTGATTTGACT
TATAGACAAAACGGTGAAGATCCAATTCAGAATGAAATCGCTAACTTCTATCATGCCGGC
GGTGATTCTGTTGTCGACGTCCAATTTTCTGCCACTTCAAGCTCTGAATTCTTTACTGTG
GGCGGCACTGGTAATATTTACCACTGGAACACTGACTATTCCTTGTCAAAGTACAATCCT
GACGATACCATTGCTCCTCCTCAAGATGCCACTGAAGAATCACAAACAAAATCTCTGAGA
TTCTTGCACAAGGGTGGAAGCAGAAGATCTCCAAAACAGATTGGAAGAAGAAACACCGCC
GCTTGGCATCCAGTTATTGAAAACTTGGTTGGTACTGTCGATGACGATAGTTTAGTCAGC
ATCTACAAGCCCTATACCGAGGAAAGCGAATAGTCGCCATGCTAAACGCGCGGAACAAGG
CCATATTTATATATTTAATGCTTTTAACTATTATTAGTTTTTCTCACCCAGGGCTGGTTT
CTTTACCCTGTGTGATGAAAGTGCGCGCCTAAAGTTATGTATGAGCTACTGTTAGTATAT
TTATTATTCAATATTTAATTAAACAATACTTACTACTGATGAAAGATACCGTACACCTGC
TGGCGAATAAGTCACTATACACGAGCAATTATATTTCTCAGGTCATTGCGACAATTGAAA
AATCGGATCGACTGATTATCATTAAGGCGTGTGACGGCTCAGAATAAGGAAGTTCTATTT
TAAAGGGCAGCAAAAATTTGGCACAATTTAAAAAGAAAGTTGGTCTCTGGTAGGGTTGGA
TCCGGTTTTTCATAACTTGCGTTTCATTTATGGTTGCGTATTTCTCGCAGTGTACATAGA
CCAAATTAACTCTATCCTTCCATTGCACAATTTGCCCAGT
Chromosomal Coordinates Chr XV from 772601-774127
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator