Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MGM1
Systematic Name YOR211C
Alias MNA1
Description Mitochondrial GTPase, present in complex with Ugo1p and Fzo1p; required for mt morphology and genome maintenance; exists as long and short form with different distributions; homolog of human OPA1 involved in autosomal dominant optic atrophy
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MGM1	6324785 upstream sequence, from -1000 to -1, size 1000
GTTTTATGTTTGAAAGTTTAAGTTACAACTAATATGAAACAGGCAAGTGTCAGTTGAAAA
CAATCTGAAAAAATTTTCGACACACAGAAAAACAACTGTTGGGTAAACCTAACAGGGCTA
CAAGTCAATCTGTTAAGGCAAAAAGCCTCACAAACTTTTTCCTGCGTAACACATGTGTCT
TTTTTTTACGCAGTATCTCTTCCTGAAACATTTTTCAACGCGTGTAAAAATTTGCATCTG
ACGAAAGTGCGTACAAAGGGTTGTGGTCCCAAAAGAGGTAGTACACGCCGAGAATTTGCA
CAGGGTACTGGTTACAAAAGGTAAGTACCCCCCGCAGGGACGGTTGAAGCTATTGAATCT
TCGTCTCATCGGCTGATATCAAAATCCGATCATACATACCCATCTCAATCTCAATAATTG
ACATTTCATTTAGCCAGAGAAGAACATCGACAAGTAAGCTGTTCTTCTGCTCGCTAATGG
TAAATGAAGTAGTCGCTCTTAAGTAATTATAAATAGTACATCTCTCTCAGCGGATGACAT
ATTGTGATAAAATTTTAACGCAGGTGTCAGTAAATAACAGAGTTGTAATTAGTTTTAACT
GCAAAAGACTTCGCAAAGAACATATGGCGGGGTTTATCCTTGAAAAAACGGTTTCCATAG
GAAGCCTAAAATATGAATGGATCTAGTGTACTCTTTGAGGAAATATATTTCAAATATTTC
TGTCCATGAAAGATTTACTATGAAATTAACCCTCATTCAGCGCTTCGTATTCGATGATCA
ATATGCAAGTTGTTAATATTTCCTTGTACCGTTAAAAACAAAATAGTAGCGTTCTATTGA
AAGGCAAGACATAATCAGCTAGGAAGGTTCACACCAGTTAACGGGAGAACACGAAAAAGC
CTCTTTTTGGGTAGTACAGATATCATTTTATTCTTAGGCTTTTCCATTCTTTTCGTACTT
ATAATATAGCCTCGCATATTCACCATAATACTCTGAAAGC
Chromosomal Coordinates Chr XV from 741569-738924
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator