Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MSB1
Systematic Name YOR188W
Description Protein involved in positive regulation of both 1,3-beta-glucan synthesis and the Pkc1p-MAPK pathway, potential Cdc28p substrate; multicopy suppressor of temperature-sensitive mutations in CDC24 and CDC42, and of mutations in BEM4
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MSB1	6324762 upstream sequence, from -1000 to -1, size 1000
CAAGCCTTTCTTGATGCCCGTTGAAGATATCTTCTCTATCTCCGGTAGAGGTACTGTGGT
CACTGGTCGTGTGGAAAGGGGTAATTTAAAGAAAGGTGAGGAATTGGAAATTGTTGGTCA
CAACTCCACCCCATTGAAAACAACAGTTACTGGTATTGAAATGTTTAGAAAGGAATTGGA
CTCTGCTATGGCAGGTGACAATGCCGGTGTTTTACTTAGAGGTATCAGGAGAGATCAATT
GAAGAGAGGTATGGTCTTAGCTAAGCCAGGTACCGTTAAAGCCCATACAAAGATTCTAGC
CTCTTTGTACATTTTATCCAAAGAGGAAGGTGGTAGACATTCTGGGTTTGGTGAAAACTA
CAGACCACAAATGTTTATAAGAACAGCTGATGTTACAGTTGTGATGAGATTTCCTAAGGA
GGTTGAAGATCATTCTATGCAAGTTATGCCAGGTGACAATGTTGAAATGGAATGTGATTT
GATCCATCCTACCCCATTAGAAGTTGGTCAACGTTTCAATATCAGAGAGGGTGGAAGAAC
TGTTGGTACCGGTCTAATCACACGTATTATTGAATAGACTTATTGATGCAACTGGAGTAT
ATTTCTATATATTCTGTTCATTTCCCCTCTCATAATATATACTTGTTTCGTTAAAATTTT
ATACGTGTAAATAAAGTGCCATAAATTTTTCAGCTTTACTTTTGGTAGAGTCCTGCTAGC
ACTAGATTTTACAATTTCATGTGCACACACCAAGGACGTGTTCTTATGTATATGTAAAAG
ATATCAAGGCGTTTTTGAATGCGTTTTTGTTGATTTGTTTACTTTCCGGCGTATTCCTAC
GAAAAAAGCAAAGAAAAATACAAAAAAACGAAACATTCGCAAATGATGACAACTTGAAAC
CGCCAAAAGTCATCGCTTGGGAATTTTGAGGCAAGAGGCTGCTTCTATAAAAGTTTTCTT
TACATGGCAAAAGGGTATTCGTATTAGGATAGTATTGGTT
Chromosomal Coordinates Chr XV from 685767-689180
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator