Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name DCI1
Systematic Name YOR180C
Alias ECI2
Description Peroxisomal protein; identification as a delta(3,5)-delta(2,4)-dienoyl-CoA isomerase involved in fatty acid metabolism is disputed
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DCI1	6324754 upstream sequence, from -1000 to -1, size 1000
CCCAGATAACTCCTCTATGGCCATTGATGTCAACTAATTTCAAAAAAAAAGTATTCCCCA
CAAGATCGTCTACTAGAGCAAGAGCTCCTGAAAGTCCAGTGTACTGCCATTCATTTTTAT
CAGGGTATGCAATGTATAGTCGAGCCACCGTAACATCAATAATCTTATTCGACGCTTTTG
GTAGAGCCCTTTTGATAATTTCCTTATCTGAAGAGTTTAGGAGTCCCATATTAAATCACG
CCTATCAACACTTAAAGTAACGAACTGTAATTTGTAGCGGAGATGGCAATCGCTACAGCA
CTTCCTTTTCTACTATGTATATTCTACATTCAATATTTATTATTACATATTCATGATTTT
TTTTCATAGGTATTGACTGGCCCCTTTTCGGACGTCTCGCACGTATTCAATGATCATATA
AACTATTTGGAAAATTCAAAAAAAAACAACTATAAGATCAGTTAAGACTTATATCATAGA
TCTTTTAAACCAGAGACACAATTTCAAGTACCATGGGCAACTGCTTGCATTGCATTTAGT
TTTGCCTTTTTTCTAATTGCAAAAGAAGAGTATTCCAAAACCACTTCTTTGATAAATCGT
CCACGTCAGCCGGCGTTACTTGAAACTAAACGCATACTTTATGAAAAAGGGCCATCAACT
TGTCTTTTTGTTAACATTCATTTTGAAAATATGAACTTTGGTATAATTGAAAATCTAGCA
TATCTATATTTTTTGAATATATTTAGGCGATAACTTAAAAAAGCATTGTTTCAGTTCTGA
AGTTTGTTGCTTGTTTCTATTCTTTACTGGATGTCTGAAACCCCAAAAAAAAAAAAAAAA
AAAGGACTCCACAAGTAGCGGCTGTAAGCGCGCTAAACTCCGACAGTGTATTATATATAC
GTAAACGATCCTGATAGAAAAATCCAATCCATTACCCCGGGATTATTTTATTACAGAGTA
GGATTTTCTGGTGTTAAGTCTAGTGAGTTATCTTCTAACT
Chromosomal Coordinates Chr XV from 675167-674352
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator