Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name DDP1
Systematic Name YOR163W
Description Polyphosphate phosphatase; hydrolyzes diphosphorylated inositol polyphosphates and diadenosine polyphosphates; has high specificity for diadenosine hexa- and pentaphosphates; exhibits endopolyphosphatase activity with a high affinity for polyphosphates, an activity also observed for its human DIPP homologs; member of the MutT family of nucleotide hydrolases
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DDP1	6324737 upstream sequence, from -1000 to -1, size 1000
ATATTGACAGGTTGTTAAGTTTCTAGAAATGCATGTAGAACACATAGGTTTTTGCTGATC
ACAACGAAGTTTTCTCCTTCTGCAAAAGCCACAAGATTTTATAAGCTTGTTTCTCTTCTT
ACCGCTAGTAGAAGTTGGTGTTCCTGAGTTACTTCCATTGGCTCCACCGGCCGTACTATT
ACTATTATCGCTTGGCGGCGTAACGTTGGTGGCCTGGAAACTTCCCAACAAAGCATCGCT
TCTTCTTTTCATTGTGACGCTATTCTTATTGGCACGGCTGAGGGCAATAAACTTTCCCAC
TTTCTCGTTGATCTTGTTGTTCCTTTGATCTAACTTTTCTCTTGTAATTCCGAATTTTTG
GCGTTTTGGTAATTCCAAGGGGAAGTTGTCTATTACATACGTCTAGTGATGTGGAATACT
ATAAATGTCTTGGTATTGTTATCCTTTTCCCCGTATATCAGCCTCTACCCCATTAGTAAT
ATGGCATGGAACCTTTTAACGTTTTTCTAATTTCCGCGGATTTAACTCCGTTCACTATGA
TTTCTGCCAGTATGATACTGGCAGAAATCTACATTCGCTATATATAAAGAGGATATACTG
GTAATAACTACAGCTTCCATGTGAGCTTAAAACGATCATGCTCATCTTTCTTCATCTTGA
TAGAGATTGGTAATGCTGTCATACTCCCGTGATTATAAAGCAGAATGAGAAATATTGAGA
CAACCGTAAAAACAGCTACTGCCCAGAATTTAAACCTTCAAACTTCATCATCAGAAAGGT
ATACTGTGTAAATAATGCGTAAATAGTAGGAGCATGGTGTTCTCTTGTCGTTGAAAGAAC
ATCTGCGGCGAGCACGTGCGGCTTAATTCTCAAACGTCTCGCGGAGGTAAATAGTGTAAA
GGGAAGCCTCAACTTTAAGACATGAAATCACACTGAAATAACGCCTGAAAGGTCAGGAAC
AGTGAGTACGTAGGAGTATAAGAGCGTGGGGAAACACAAA
Chromosomal Coordinates Chr XV from 642741-643307
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator