Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPT5
Systematic Name YOR117W
Alias YTA1
Description One of six ATPases of the 19S regulatory particle of the 26S proteasome involved in the degradation of ubiquitinated substrates; recruited to the GAL1-10 promoter region upon induction of transcription; similar to human TBP1
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPT5	6324691 upstream sequence, from -1000 to -1, size 1000
GAGATCTCTTGTAGACACTTCCACTTCAGACTGGGCGACAATATCGGCAGCGCTTAAAGC
GCTAAATTCCAGCCCTTTAATCCTTTTCGGGGTTTCACTTACAACGACTTCCTTCATCGA
ATTCTTCGAAATTGCGGGACTCGCTTACAGTTTTGGAGAAAGCAGATAGTATTGAACACA
ATAAAGGAACAACTATGTAACCAACCAGTGATGAGTTTAAAAATTTAGTGCAGATGGAAA
AGAAAAAAATGATCTAGTATACTGTCTGCAATCAACAAAAACTCTAGCCACAACAAACTA
AGCAATCTTCCCCAAATCAACGATATTGTACGATTAATATATGCAAAGAATAGTAAGGTA
AGCTATAGTAAAAGGGCAAGTTTAACCTCTTCTGTTATTTGATCTGGTGATGAGTTCTGC
CAGAAGAGCCTGTGCAATAATTTTGCAAAAAAAATGGCAAATTTCGTGAAACACGATATT
CACGTATATAGTGATGATAATAAGCATGCTATATATCAGTAGTATGTATTTTGCAGCTTC
TACTTTCTGCAATGTGATGCCGTTGGCATTGAGATTCCAACGAATATACACAGATGCCTG
ATTTGTTTGCGATTAGTTACTGTAATAGAGAAAAAAAAATTTAAAAAAGACGAAAGCCCA
AAAGAGACGAGTGCAATTAGTGGCTGATACTTTATACTATGTTTAATATATATACCTGGT
TTACCTAGTGAGTATGTTCGTAAAAAAATAACGTCAGTAATGGTTGTTGGTCGGCAGCCT
TGGCGAATTCCTTTTATTAGCAATGGTTTAATCATGTAGTTACCCGGCCAATATGTGGTG
GCAAAAATGAATTAATGTATATTTTACTGAAAAGGACCCCATTAATGAACTCTTGGGTAA
AAAGGGCACATCAGGAGTTTGTCTAAAACGTTTATACGAGTGACTTATTTGTGCATTATA
GAGGTGAGAACAAATTGGAAAGTTTTGATTTTAGTTTAAG
Chromosomal Coordinates Chr XV from 545029-546333
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator