Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name NUP1
Systematic Name YOR098C
Description Nuclear pore complex (NPC) subunit, involved in protein import/export and in export of RNAs, possible karyopherin release factor that accelerates release of karyopherin-cargo complexes after transport across NPC; potential Cdc28p substrate
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NUP1	6324672 upstream sequence, from -1000 to -1, size 1000
GAATTCATCAGTGAACTCTTCATCATTCAAAAACACCCAATCATAGTTGAACTTGGAGTT
AAATCTATCTTCCACGGATTTAATAGACTCAGCCAACGAATATAGATCTCTATTACGCAC
TAGAGTGACAAAAGTGGCCTTTTCCCGAGGACCGGTATACTTTGGTAGTTCCACTTTCGA
GTATTTATAGCCCGAGCCGGAAGATAGCACGGTACTGTACTTTGGGCTTGGGGCAGAGCC
TCTCGCATACTGAGCTCCATGAAAGAACACATACACAGTAAACACGGCGACCAGAAGAAG
TCCTAATTTTTTGTAAACAGGCTGCTTGCTAGCTGGGATCATAATCTTCGCCATTTTGGT
TATTGACTCTATCCCTTAAAAACTCTTCTGATGGAGTACTTTACTTCGATTGCTTAACGA
AATCTTTGTGAGGAAAAAGATATCTCTTAAAATTAGAAAGTACAATAGTCTAGCGTATTA
TACTAAGAATCTGCAAAAAAGAAGCAAGAAGGCACCACCTATTATAGACCTTTGACACGA
AGTCTCTCTGGAGTGCTTTGGCCTACGTGTGCGGTACTCGTTTACATGGGACAACCACGG
TTTTTTTTTTGGTGTTACTGGAGGTATACAGTGCGTATATCCACTTGTACGACAAGAGAT
TTACACTACACCGCGTAAAGAAAACGCCGACACCAAATATAAGTCACGTGTATGCAAAGC
CTATTTTATGCCCTAATTTTCAAGCCCCGGTTTTTACGCCCTAGTTTTTATATTTAGGGT
TTGTCGTTGCACGTGATCAATGGTTCGTATTATGTGACATTGAAATGCTTTTTCATTTTA
ATTTTTTTCTTTGACGAAATTTCGTAATGTCAAGAAACACTTAAAGAAAATAAGTGATGA
GGAACTCAATAAGGACACTACGTAGCGGTGCAAATACGATAGGATATTAGCCTCGAAAGG
GTTATAGGGACAGAGAGTGAGCGACAATTTTTAGTCATTC
Chromosomal Coordinates Chr XV from 511178-507948
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator