Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SMF1
Systematic Name YOL122C
Alias SBS1
Description Divalent metal ion transporter with a broad specificity for di-valent and tri-valent metals; post-translationally regulated by levels of metal ions; member of the Nramp family of metal transport proteins
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SMF1	6324450 upstream sequence, from -1000 to -1, size 1000
CATTAATGCTTACGCTTCTTTCTTGCAAAGACAAGGTAAGCTAGAAGTTCCAGGTTACGT
TGACATTGTCAAGACCTCTTCTGGTAACGAAATGCCACCACAAGATGCCGAAGGTTGGTT
CTACAAGCGTGCTGCCTCTGTTGCCAGACACATTTACATGAGAAAACAAGTTGGTGTTGG
TAAATTGAACAAATTATACGGTGGTGCCAAGAGCAGAGGTGTTAGACCATACAAGCACAT
TGACGCTTCCGGTTCTATCAACAGAAAGGTTTTGCAAGCTTTGGAAAAGATTGGTATCGT
CGAAATCTCTCCAAAGGGTGGTAGAAGAATCTCTGAAAACGGTCAAAGAGATTTGGATCG
TATTGCCGCTCAAACTTTGGAAGAAGACGAATAAATATAAAATCTATAATTTATATATAT
ATACTACTACTACAATTATCATCATACAAGTAATAATAAAGTTTAAAAGCTACAACGAGG
AGGGGAATCCTATTGCGAAGTTTGGTGTCACATGGTTTGAAGAGCCTTGTTAACGCGCTC
TTCTCAGTTCTACTTTCTTCTTCAATTTTGTTGGCCGATTTTCTTCTTTATTTGGCTAGC
CAGTAATTTTTTTTACTGCATATAGTAACCGCAACGCCAGTAGCTTGGAAGGAGCGTTGT
TTAAACGACAGCCGTAAACTTAGAATAGTACAGAGTACTTCTGTAGTAGTAATGCGCGCC
AGAAACCAGCTTGCTTAGATGTTAAATCATCGGAATCAATCCTGTTCGCATTCCTGTGCC
GAAAATATTTCGACGTACTACGTGGACCCTAGCGTCCCTAAATGCAACAGTTTTTTCTAA
TTTAGGATTTGTTAACTCCGCCGGGGTGATTTGATGCTGCAATATAAATATACATAGAAT
AATATTTGGCTGCTCATCATTGTGCGAGCATATTAATATTTCATGAATAGGTAGAAAGAT
ATATATCAGCAGAAAAACTAACTTTCTCAATTAGGTCAAA
Chromosomal Coordinates Chr XV from 91419-89692
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator