Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TPT1
Systematic Name YOL102C
Description tRNA 2'-phosphotransferase, catalyzes the final step in yeast tRNA splicing: the transfer of the 2'-PO(4) from the splice junction to NAD(+) to form ADP-ribose 1''-2''cyclic phosphate and nicotinamide
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TPT1	6324470 upstream sequence, from -1000 to -1, size 1000
TTTTGTCTCCTAATATTTTTCACGGACTTTTATTTGATACCTTTGTTCCCCACCACCACT
ACAATGACAGACTACATTGTATTCAATTTTTATTTATTGAACGTTTTTGTATTTTGTATG
GTGCATTTCATTTATCACTTCGTCAAAAATATTTCTCTACAACAACATCTCGAACATTGG
CAGAAGTTTTCGTATTTATCGAATATCAACTTATTGATATCATCACAAATCACAATTCTT
TATTATCTATTCTATGATTACGTGTTTTTCTTCAAAATTTTTACCCTTTTAATGAACTTC
ATAGGATTAGTGGCATACTTTTTTATATTGACGGACAAACTCATTTCCTCGAAAAGATTC
AATAAAACAGTTTTCTTCATTTCGGTATCAGTAGTGTGTTGTTCCTTGCCACTATTAACC
GCAATAATCACCTTTGATGGTTTAGAAAACCTGAAAGAGAGGATAAAAGTGAACGCAATT
ACGTGGGAACTTGTGGCTTTGGTAGCGGCATCTATAATTTACGTTACCAGGTTCCCTGAA
TCATTGTTCAGACGAAATAAAAAGGAAGAAGGTTGGAATCATTCCGAGTACCTTTTCCAT
CTCTTGATTTCTGGTACGGCTTTTTACCATTTTTTCATTTTGATTCAATCTTATATTTTG
ATGCATTCAAGTTTGAATCAGCCCGAATTAATTAATTTCAAGTCTTAGACTCAGCTGGTG
CTCACATAATAAATAATTGAATAAATAAGGCAAATTAAATAAAAAAATAATTCAAGAATG
GGAAGTGTATCTCCTTTAAAGATACTTACACGAGTTGAATTAAGCTTCATGTTTTGACTT
TAATGTCTTCTGCGGTTCTTGTCCGTATTTCTGTCTTCGTGATGTATTTGTTCTTTTTTA
CTGACACCGTGACGCGAGGAAAGCTCATCAAAATAATGGCAAAATGCATAATACATTATT
ACAGAATTGAGCAGAATGACTGGGAAAGGTGGACTTGACA
Chromosomal Coordinates Chr XV from 126689-125997
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator