Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name IRA2
Systematic Name YOL081W
Alias CCS1, GLC4
Description GTPase-activating protein that negatively regulates RAS by converting it from the GTP- to the GDP-bound inactive form, required for reducing cAMP levels under nutrient limiting conditions, has similarity to Ira1p and human neurofibromin
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IRA2	6324491 upstream sequence, from -1000 to -1, size 1000
CGAAACTCTTTACTTCCTAAGGCCTCTCATTACTTATCACCTAGCATCATGCTCTTCATA
CATGCCATCTACTTTCAAACGATATACGGCTAACCAGAAAAGTACGGACAATCAGGGACG
AGCAGGGACATGACGCCTTCCGCACAGATCCCAGAGAAAAGCAGGGAAACAAGAAAATAA
GAAAACAAGAAAAACAGTAGTTACCCTTGTAAGTGTCATCCACAACAGAACCAATACTCT
TACTCTTCCGCTCATTCCCCGCAGAATGATAGAACTATTCTAAATCCCCTTGCCTTGCTT
GGCCTTGACTTGGGTTGGGACTTGGACCTCTAGAACCGATGTGCCTTCAAACATCTTAGC
GAGATAAGAGTCTGCCATTAATGCATCGAGCCAATATCTTGGACTAGTACGAGGTTCACG
TAGCCTTTCTTGCACGGCACCAGCGTCCCACCCCAAGTTCTTTGCTATACTGACCGCCTT
ACACATTTTAGTGTGATTCCAACCCAAAGTAGCTCCTCAAAAAGGGTCACCCGATCGGTG
AATCAATCCGCGGCGCAGAAATGTTCGTAGAGCTCTCGTTTCTTCTAGAACGCTCCCTTG
ATGAAACGAAAATTTCCATCACAATAAAGCTCGCACGCCTTTTTGAAAACCCCAAGCTTT
GCTGTGTCTTCTTGTGAAAAGTTTTGCCCAACGATTATCTATTCTACATATAACCGGGGA
GTTAAGCACATCCTATTGCCCTACATTCTCTCCGCTTACTTCATTGTCTAGAGCTCCTGG
GAAACAAAAGACCGAAAAAGCGAAAACAAAATCAGAACAAGGCTTAAGTACTTTTTCACC
AATTGTAGCAAACATTTAACCACATTTTAGCACACTAGCATATAGCATTGTCCTCTGTTA
TTCGTTTTGCTTTTCTCCTTTAGTGTTACTTTTCCCCCAACGTTACACCATTTTTTGATA
TCAACTAAACTGTATACATTATCTTTCTTCAGGGAGAAGC
Chromosomal Coordinates Chr XV from 171070-180309
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator