Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PRE6
Systematic Name YOL038W
Description Alpha 4 subunit of the 20S proteasome; may replace alpha 3 subunit (Pre9p) under stress conditions to create a more active proteasomal isoform; GFP-fusion protein relocates from cytosol to the mitochondrial surface upon oxidative stress
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRE6	6324535 upstream sequence, from -1000 to -1, size 1000
GTAACACCCCAGATGCCACCAAGATTAAGGCTATTTTGGAATCCGTCGGTATCGAAATCG
AAGACGAAAAGGTTTCCTCCGTTTTGTCCGCTTTGGAAGGTAAGTCTGTTGACGAATTAA
TTACTGAAGGTAACGAAAAGTTGGCTGCTGTTCCAGCTGCTGGTCCAGCTTCTGCTGGCG
GTGCTGCTGCTGCCTCTGGTGATGCTGCTGCTGAAGAAGAAAAGGAAGAAGAAGCCGCTG
AAGAATCTGACGACGACATGGGTTTCGGTTTATTCGACTAAGGTTGAGTAAATTTGTGCA
ATCTCGTTATATCATATCTTGGAAGTTATAGAGGGAAGGGCGCAAAAATAAACCCTTTCC
TCTTTTTTACGGCGACCATACTCTTTTTTTCCTAATCCTTTTCAAGTTTAAATCCATGAT
TTAATATCTATTTATACATATAAATAATATAAGTAATGGTTTAATGCATTGTTTCAAAAA
AAAAATAAAAAAAAAAGGGAAGAAATTATATATAAATATACTTCTTCATCTTCAAAATTC
AAACCGATTGTTTTACTGGTTAGAATATTATGTGTGCTCTTTCTTTGCTCTATGACATGG
CTCTGTTTTGTACCTTCCTTTTTTTTATGCTATTGAATAAATTTGTTGTAGCCGCTTTCC
TCAGGAAGGACCCCATGTATTTCATCAAATCATATAAGTTGAATATCCCATCAATTGCGT
ACCTAGTACTTAAATAAAATACTCACGTCGCTTTCTTTGAATATTTGGAAATGAATTGAG
ACCTAGTGTGCTGTGTGCCCTTGTTCATTGACGATTAAAGCTTTAAGGACCATTACTATG
GGTAAGAATATCATCCGGGCAACGGTATTTCTTAATCTTTTCGAAGATTCTTTTGCCACC
GGAAGGGAAAGAAAAGACATCATATATAGGTGGTAGCAAAACCTTCAAGTTAGTGCTCAG
CAGTTCATCAGGATCAGTTGCATAAACACAATTACACAAA
Chromosomal Coordinates Chr XV from 255337-256101
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator