Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RCL1
Systematic Name YOL010W
Description Subunit of U3-containing 90S preribosome processome complex involved in 18S rRNA biogenesis and small ribosomal subunit assembly; stimulates Bms1p GTPase and U3 binding activity; similar to RNA cyclase-like proteins but no activity detected
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RCL1	6324564 upstream sequence, from -1000 to -1, size 1000
CCAAAGAAGAAGTATGATTCAAAACGGGTTTGAAATTGCAACTAGGAACAACTTCACTGA
TGATCCTGAATTCATGGGCTGCGTCGGCTGCGCCATCATTAGACGTAAGCAACAAGCTTT
GAATATTACTTTGCCTCCGGAATGTGAAACCTGTTTTAAAAATTATTGCTGGAATGGTAC
CCTGGATACTACCCCATTACCAGATGTTGAAAAGGATGTTCACCACTCCTTTATCAACGT
CAATAGCTTCAACAGCTCCATAGGACAAGAAGAAAGTCTTTACGCCGGATCTTCAGCTTC
CCAGTCATCGTCTTCATCATCGTCTTCATCTTCGTCTTCGGAAATTCCTTCGGCTACTGC
AACCCTTGAGAAAAAGGCAGCTACTAATTCTGGATCACATTTATCTGGCATAAGTGTAAA
GTTCTCTGCTATGATTATGCTTACTTTATTGATGTTTACCGGAGCAGTATAATATCTCTT
GCGTAATAACGGTATACAAAATGAGGCAATAAAAATCAAAGAACTACACTATAAAATAAC
GAAACATAAAGCTGAAAGACTAGCAAAATCACTAAAAAACTAAAATAAAAAAAGAAAATG
AGCATTTCCCCTTTGCATTGAAGTATCATCCCTTTCGGGCAAGACCATGTTTAAGGAACT
TCACTAATGACATCGGAGGTCTATATATAGCAGACCTCTTCTTTAAAAGATATAACTTTA
TAATTATAACCCCGCGCAAAGCGTATTAATACTTTAAATGGGTAGTCAAGTTGCTTTTAT
TACTTGCACTTACTTTGAAGGAGGATGTCAGAATTACCCTCGCCATATTGGTAATGTAAT
TTTTCACGGACTCGAGATTGAAAAAATTTCAGAAAAATTTGCAAAAAAGTGCCGATGAGA
TGAGCCTTCATAAGCTACGTATGTTGTAAGGGTATAACATCTGTCAAGCTTCACCATTGT
CAACACTTTTCCACTAGGATAATCCTCCAAAAGTATAGCA
Chromosomal Coordinates Chr XV from 307938-309041
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator