Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPB11
Systematic Name YOL005C
Description RNA polymerase II subunit B12.5; part of central core; similar to Rpc19p and bacterial alpha subunit
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPB11	6324569 upstream sequence, from -1000 to -1, size 1000
ATATGTGAGCAGCATGAGAAGTTAGAGCCTGTTGGCCATTGGAATCTCTTCTATCTTCCT
CCTTAGTACTCAAGGCAGATAGCGAGGGTAAAGTAATCCGTTGCTGCTGTTGAACAAAAC
CGGGCTTATTTCCCTGGAGGGACGGTTCTTTTTCGTTTCTTTCGTTGGAACCCGTAGCGT
CATTTGAAGTAGCCACATCGTTTGATTGCGAATTCGAATTATGCCAAACCTGTGACATTT
TTGTACAATGTATAACTTGTTTCTTAGATATTTTGTCCTTTTCCAAATAACCTCAAACGA
ACACAACAAAAGGGTAAAGAGACTATACTGAAAGCGGTCAATAGCGTAGCCTGTTGTGGA
GGGAGGGAAGTAACAAAGAATATGTGGTACGTGAATGAGCTGATTAGTTAGGTACGGTGC
CTCGAATATTAGCAATGCTGGTGCGAAAAAGGGAAGACAAATGTAATAGGGAAGGGGAGT
AACCGTTGTTTTGCAAATCACGTTTGCTGAAGAACTGCAAAATGAAGGCGACTTTTTTGC
GAATGGAAAAAAATCACTAGAAAATCCGATATCATTACCCGTACTGGTTTATTCTACGTT
ACACGGGTAACCCCGCAGTGTGTGCCACACTCTGGGCAGCGCGTAACAACAGTAGTTACA
AGACTGGAGTAGAAGATAGATTTTTTAAATTATAAACAGAATTTACAGACTACTGGAGAG
GGATCACGGTAAGCCTCGTCGGTAAGCCTCGTCGGTAAGCCTCGTCGGTAGATCCGTGTC
ATGTCATGGATAATGCTGCTATCCGAGTTCAAAAAACTTGCAAGCTCAATATTATCATTA
CCCGGACTTAATAAAGTGGAAGTGTCCGCGAAAATTCTAGGTTCACTGCTTTGGCACACA
CAAGAGGTCCGTTAAAAGAAGAGCGAGAGAACTGAGCCGTGCAGCCTAAATAGATAGCTA
CGTAGCCACCAAACCAGATACATTTGGACACAACTGCATC
Chromosomal Coordinates Chr XV from 316175-315813
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator