Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name POP2
Systematic Name YNR052C
Alias CAF1
Description RNase of the DEDD superfamily, subunit of the Ccr4-Not complex that mediates 3' to 5' mRNA deadenylation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>POP2	6324380 upstream sequence, from -1000 to -1, size 1000
GATAGAAAGCAAATATCTGTAGGGTTTATCGGCTATCCAAACACTGGTAAATCGTCCATC
ATTAACACATTGAGAAAGAAAAAGGTGTGTCAAGTTGCACCAATCCCTGGTGAAACTAAG
GTCTGGCAATATATTACTCTTATGAAAAGAATTTTTTTGATTGATTGTCCAGGTATTGTG
CCGCCTTCTAGTAAAGACTCCGAAGAAGACATTTTATTCAGAGGTGTTGTCAGAGTCGAA
CACGTCACACACCCAGAACAATATATTCCAGGTGTTTTAAAACGTTGTCAGGTAAAGCAC
TTGGAAAGAACTTACGAGATCTCAGGATGGAAGGATGCCACGGAGTTTATTGAAATTCTG
GCAAGGAAACAAGGTAGATTACTGAAGGGTGGTGAGCCTGATGAGTCTGGTGTTTCTAAG
CAAATATTGAATGATTTTAATAGAGGTAAAATCCCTTGGTTCGTCCTTCCACCTGAAAAG
GAAGGGGAAGAAAAACCAAAGAAGAAAGAAGTTGAGAAGACGGCATAGAGGTAAAAACGG
ACAACCGGTGTATAATATTAATTTAAGATTACAAGTGATTTTTTTTTTCTTTTTTTTTGT
TATTTTTTTTTTTGTTCTTATTATATGGCAGCAAACATTCTTGGGGAAACAACATAGATG
GGTAATTATTTAGTTTATAAAGTATAATATTCCAATAGAAAACTTAAGTTCGGTAATGAT
ATAGCCCTCTCTATAGTATAAGGTAAATCTCATTATACCAGTCATTCCAAACGGAATTCG
GTCCTTACCCGCTGCTCGCTCTTTTTTCATCATTATGATATTTTCTTTATTGAGTCTTTT
CAATTATAGTAGTAGAATGATAACTGACAAGAAAGATCAGTTTGAAGTTTATTAGCGTGT
CTCGTTATCAGGGCTTCCTTGTTTTTCATACTGGAAATACTTCGAACGATTAGAAACAGG
CAACTCAATTTTATACATTTATAAAGGGTCAAAAAGGATT
Chromosomal Coordinates Chr XIV from 720647-719346
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator