Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TIM23
Systematic Name YNR017W
Alias MAS6, MIM23, MPI3
Description Essential component of the Translocase of the Inner Mitochondrial membrane (TIM23 complex); involved in protein import into mitochondrial matrix and inner membrane; with Tim17p, contributes to architecture and function of the import channel
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MAS6	6324344 upstream sequence, from -1000 to -1, size 1000
CAGTGATTGTGCTAGGCTATACTGTGCCAGAATACGACTGGGAGTGCTGTTCTTCTTATA
TATCTTGGCGCTGATTGAGCGTATAGCCTAGTTCACCAAGCAGTAGAGAGAGTGGCAATG
AGCGGTTGAATTTCGACTGCGACTTGTTGGCACAACGCGCGCGCGGCCGGGCCATGTGAA
GATTTTAACGGGCGCAACGATTCGGTGGGCAGTGGAAATTGTTGGGCGTTGTTCAACAAG
ATGAAGCATTCCCCTTTGGATAACGTCAACGCATATCGGGCCAACCTACAGGCAATGAGC
GAAAGCGACTGAAGCCGAGAGATGTGCCCGGAGTTTGTTGTTCTTGTTCTTGTTCTTGTT
CTTGTTCTTCTTGACGGATGATACTAGTCGCAGTCGTGGTGACTCTGGAGGGCGTAACGG
CCGTGATGCGGCCTGAGCTCACTGTGACGTCGATGCATGCGCGGGTTCGTTGCGTTCAGG
CCTGACGGGCGATTCCCCACCAAGTATAAGTGTCATGATATACGCGGCACCTGAGCAGCA
CATTAGGTCCCAATTCAACCCAACATATATAATGGTTCTGTATGGGTATTTTAAGTGTGC
AAACAAAATGTGAGTTACCCGGCTGTTTGCTAGTCGCTGCGTACGAACTGGCTTGCTAAA
GCTGGGTAAAAATAATTTAATCGCAAAAGGAAGAAAAGGAAATCGACGATTCATTGAAAA
AAAGAGAAAATACTGAAAAAAAAAAGACACCGACAAAAAAAAGAGAGAAAGGAACCTTTA
CGTAGAGCAAAAGGGAAACATTTGTTGCGTTTAATTAATAGAAATAATAGGTTATTGCAT
TCGCCCTCCATTGCAGAAAAAAAAAAAAAAAAGACCATTTTCCTCTTCTACTCTCTTTGC
CTGTACATACTACACGTTATAGCGTTAACAAAAGCAGATAGAAAAAAAAAAAATAACCAA
GATAATATAGGTATACTTGTTTAACAGATCACACACAATC
Chromosomal Coordinates Chr XIV from 662913-663581
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator