Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ATP11
Systematic Name YNL315C
Description Molecular chaperone, required for the assembly of alpha and beta subunits into the F1 sector of mitochondrial F1F0 ATP synthase
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATP11	6324014 upstream sequence, from -1000 to -1, size 1000
ATATTACGTAATGTTTGTATAAATAGATACATATGGACATGAATCAAGCATATCTAATAG
AAGTTTTTATATTTTATCTCCTTGGCTGGGTGGTCTCATCTGTGAAAGGAGAGCCTCAAT
TATGTTGAGCTTGTTTAAAACTTTACACTCAAAATCTTCTTGCCTTTTCTTTATCACCTC
GAGTTCGTTGTGAAGATAATCTAGACATATTTCCAATTCCATATTAGAGTCCGACCACGA
TTGCTCAGCAGCCATTTGTGGAGGCAGTACTGTCTCGCTGAACCTATTTGTACCCTTGTT
TATCTTAGGGCTTTTGATGACTTTCCCGACGTCGTTATCCTTAGACAGAATCATGGGGAT
TGTGTGAAGAGTAGGCGGAATTCCAATCGTTATTGAATCCAGGGGCAGCGGTTGTGAGCC
TGAATGCTCATCGTCGGAGCTGTGGTTATTCGGATGTTCAGCGGATGATAATTGTTGAAA
CGGATCAGGCCCCGGATGACTTTTAATGAAAGAAGATGATGATAAGGATGAAGATGATTC
ATTTCCGAATTTAGTTCTTGGTCTTGGATGTTCTGGTGCTTCGTCCAAGAGTGCTCCCAT
CAGCTTCAACTGGGAAGGAGAGAATTGGGCTCGATCTGCGCTGAAGAGGTCCTTCAGTCG
ACGAAATTTGGTTTTTAACGTCCTTGATTGTCTATATCTTGACCCAGTCTGTCTGTTGTA
CTCATCGAGCACCCTTTGCCAGCTATCTTGTCTGTAGGCATATGGTTTCAGATGAGGTTT
GTGCCGTATCAGTAGTCGTAGAAGCAGCTCCACAGGATCCACCGATTCATCCATTATGGT
TGGCTCCGCCTAAACCTTTCAAAGTATCGTTAAACCATGTTGTTATCAATGGTTCAACTC
ACCCGAATGGAAATAACGCTTATTTTGACGCCGTAATCGAAGGATGTGAAGAACTTATCA
AGACTTGAAAATAGAGAACAAAAGAGATTTAAGAATAACT
Chromosomal Coordinates Chr XIV from 44280-43324
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator