Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name YPT11
Systematic Name YNL304W
Description Rab family GTPase that interacts with the C-terminal tail domain of Myo2p; mediates distribution of mitochondria and endoplasmic reticuli to daughter cells
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YPT11	6324025 upstream sequence, from -1000 to -1, size 1000
CCAGCCAAATGCACGATACTAGCGATACCACCATGCAGATGTAGAAGAGGGCGATATGCG
ACATGATAAAGTTCTGCAAAGAAGTGGAAACGCTAGCCCAGTAGCAGAACGACAAACTGG
CCAGTAACTGGCATGACAGCAGAGAGTAAACCTTGTGCATAAACCGCTGGCGAATGATGG
GTTCGCACGAGATAACCACCGTGGAATATTTAAAGTCTTCCGGGATGAAAGCGTTTCCAT
CCTGGCTGCTCGCAGGCTGGCCGTAAAGATGTGAGCTTTGCTCTTCGTAAGGAGGTGGAG
GACCTGACATATTAACTTGATTCTATATCCTTTTATTTGCTGTTGCTCTTGAAATATTGT
CAAGAGTAAGATGAGTGTTATAGCTGATTCTTTTCTTTATCCCGGAAAGATCCTTATTAT
AGCCTCAAAAGGGGAGCGGCCGGGTACCCTGGTTGCGTTGCCGCCCCAATCTGCCATAGG
CCCACCCATAAGAGTTTAGAAATGAATTATTCCTGGGCCAATGCTGCGATCACGAAAATT
ATCAACATCTTGATAAATTAATAGCAAGTTGGACTAACTTACAGGTTTTCTCGTGAGGGA
AGTGGAAGAGAAAGAAGAAAGGAGCGTATGCAACTGCCCTTGGCAGCCGCCCATCGTCAC
TCATGGCCGTTACGCGCCGCGGCCGAAACACGCCAAATGCTATGTACATAACGGAAATGC
TAATACGTAACAATATAATAATATAAAGCTTTCATAAGTCTTGGCACTGGCACTTGCATC
AGCATCTCGTATATTAGATACATCATCAAGTCCATATGTCCCAGAGAAAGCGATACTCAT
TGAACGTCGTCACGTCCCCGTCGATACCGTCACCGACACCCAGTGCACCGATACGGACTA
ACGAATCCAATTGGGAAGCTGTTCGCCAGCGAGTGCTGCATCTTCATTTCTCCCGAATGT
TCATCATGGTGGCACGGTTTTGAATCCTGGGTTGGGCATA
Chromosomal Coordinates Chr XIV from 60297-61550
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator