Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MSB3
Systematic Name YNL293W
Alias GYP3
Description GTPase-activating protein for Sec4p and several other Rab GTPases, regulates exocytosis via its action on Sec4p, also required for proper actin organization; similar to Msb4p; both Msb3p and Msb4p localize to sites of polarized growth
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MSB3	6324036 upstream sequence, from -1000 to -1, size 1000
TTCCTGAGCTCTTTGAAATAGCCTAATGACAATGCCGACTTGGCAAAATTGGAACATTAA
AGTAGCCAAGAAATCCAAGACAACAAATGTCATATCATCGGAAAAGATGTGCATAATGGA
ATGAGCCCGAACGACACCATAGACATTGTGCTCTTTTTCCAATCTCCGCAACACCTTCGT
GATAAAAATCGTTAAGTTCAACGAGGCTAACAACGAGGCTATCCTCAGTAGTTGTAGAAT
TCTCTTATATGCGCGCCCGCTGATATTTATACAGCATATCACAGTCAGGAACACTGTGAT
GACAAAATTAGAAGTTATCGACAAAATCACAGCATAAATCGCATACTCAGCAGAACCGCC
GACATAATCGCTTACTTGAATGAATTTTTGCCAGTCATTGATCACCTCATCAAGATACCT
ATATGGGGAAGAGTTTCTTAGCACCGTAGATACATAAACGGGCACTCTTTCACAGCAGAA
ACTCCTAAAAGTAATATCTTCTGCATATACTGCCGAATTGTCATAAAGAGGCAATTGTAT
CAGCACCCCTGAACCTAGCTTCATTGGATGACAGCTATTGTAAGCAGCCAATTCTTCTGG
ACTATGTCTCCACAAGTTCATGTTTGCAGAATCGACTATTCATCGAGTGTCTTCCTCCTT
ATGTGCTACTAAAAACGATAGTCTAAAATGACTGATTAAGTGCGCACAGGAAAGAAGAAA
ACAGGTAAAGGACACCGAATCTGTAGTACCAGTCTTTTGTCTTTCTTGTAACTAAACGAT
GTGGGTTGCTCTTCTAAAGTACTTATCTTTACTCGCCGATACAACGGGTTCCATCTTCTC
TTTCAATAGCTGCTATTTTTCTGTTCGGGCAGTATCAGAATTAACAGGATCAAACCTCGT
TTATGTCACGTAGAAAGAAAGTAGCTAAAAATAGCTAAAGGGACATCTAGAAGCTTTGTA
GGAGTCAAAGAGTTGCGCACCCAGAACCATTGTAATTAGC
Chromosomal Coordinates Chr XIV from 80640-82541
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator