Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ATG2
Systematic Name YNL242W
Alias APG2, AUT8, SPO72
Description Peripheral membrane protein required for vesicle formation during autophagy, pexophagy, and the cytoplasm-to-vaucole targeting (Cvt) pathway; involved in Atg9p cycling between the phagophore assembly site and mitochondria
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>APG2	6324087 upstream sequence, from -1000 to -1, size 1000
CAAATCCTCAGAACACTTACGTGTTGACGTTCCTAAACCATTGTTGTCATTGGCATTAAT
GATTATTGATGCTGTTGTGGCTTTGGTAAAGGCTGCTATTCAGTGCCAAAATGAAATTGC
CACCACGACAAGTATTCCTCTGAACCAATTCTACTTGAAAAACAGCAGATGGACAGAAGG
TTTGATCTCCGCGGCAAAGGCTGTGGCAGGTGCAACCAATGTTTTAATCACTACTGCTAG
TAAGTTAATCACTTCTGAAGACAATGAAAACACATCACCTGAACAATTTATCGTCGCCTC
CAAAGAAGTGGCCGCATCCACAATACAATTGGTAGCAGCATCGAGAGTGAAAACTTCCAT
CCACTCGAAGGCCCAAGATAAATTGGAACACTGTTCCAAAGATGTTACCGATGCATGCAG
AAGTTTGGGTAACCACGTCATGGGTATGATTGAAGATGATCATTCGACTTCGCAACAGCA
GCAACCATTGGACTTCACATCCGAACACACATTGAAGACTGCCGAAATGGAACAGCAAGT
GGAAATTTTGAAGTTAGAACAATCCTTGAGCAATGCCAGGAAGAGATTGGGCGAGATAAG
AAGGCATGCCTACTATAACCAGGATGATGATTGATCATGAATTGTACTTTTTATATATAA
AGATAAACGTTAATATAAATATATTTATTTGAAGACGTCTTTTACGTTTTTCTGTATCTG
ATTGGTATATGCGTTCTCGTCCGGGGACATTTTTTCTTTTTTTGGTGCGGCGAATGGAAA
TAATCGCGATAATGAATATGCAAGGAACAAAGAACAGACACCCCACCCTTATTATCATAT
CACATCTCTGTAGGAGTCTACCATTTTGCTTCTATTGTAATCTTTGCGACTTTATTTCAA
CTCACCATTCATACAAAATTTCTACTGCCGTTTAAAATAAGGAAAGCATAAAGATTAAAG
CAAATTAAGAGGAACCCTTTTTTTTTTTGATTTCGATACA
Chromosomal Coordinates Chr XIV from 191324-196102
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator