Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PDR16
Systematic Name YNL231C
Alias SFH3
Description Phosphatidylinositol transfer protein (PITP) controlled by the multiple drug resistance regulator Pdr1p, localizes to lipid particles and microsomes, controls levels of various lipids, may regulate lipid synthesis, homologous to Pdr17p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PDR16	6324098 upstream sequence, from -1000 to -1, size 1000
TTTCAAAGACGGCGGATTCAACATTGCAAAAAGGCATGCGCAACGTGTGGCCTTTGGTGG
CCAAGCGGGCGGACAATCGTCTTCCCCCAAGAAAGGCCCATTGTCCATCAAACCGGAGCC
TGTTAAGGTAAATCGTCAAATGGATAATGTCACAGCAGAGAAGAAAGATGTTACGCAGCC
CATCACGCCGGTGAAGAAGAGAAGATCCGAATCACCGTCAATCTTTCTCAATCGTAAAAA
ACCTGCGCTATTCAGGCCTACTCCGAAGACAAACGCTGCAGGTTCTCGACCCCATACAAC
AGCGATCACCAACGATCACCGTACTACTTCTCATCCTTATCCCCACAAAGATGTTGTAAC
TTCAATATCAAGTGTCACCGCAAATCCCGTAACAAAGGGCCACAAGAAGAAGAAATCCGG
AATTTTCGTACGAAATGCCGGATCTGACGGAGATAGTTTTCCGCACGTGACCGCAACCGG
CCCTACTACCCGTCCGTATATCTATGAGCCACGGAAATAGCAGTAACCCAACTCCGAAGG
CCGTCACATCCCCTGCGATTTCCCACGGGTCCAGTCATTCCGCGGAGAAAGAAAGCAACC
GGAAGCAACGGCATCCCTGCTTATAAGCGATTTTCGCGTTGCGCGTCATCTTTTTGTCTT
CCGTCTTAGTAATTTTTATGATTTTTTTCATTCCACCCGACTCTATTTGAGTGCAAGCAT
GCGATATATCTCTCTATATATTGCCAGATCTTTATCGCAATAGGTTCATGCACTATATGC
GCATCCCACTCTTGTACATGCACAATATTGTGCTCATTGTCTGAATATATATATATTTAT
ATATATATATGTATGTATATATATCAGTTCTAGATAGACTAATACCACTTCTTCGTTAGA
AAAATATTTCAATCCTTATTTTGTTTCTAACTGTTCCCTTCTCTCCATCCAACAAATAAT
ACAAAACCACTTTATATAAAAAAAATTACAAAAGCAAAAA
Chromosomal Coordinates Chr XIV from 217042-215987
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator