Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GIM3
Systematic Name YNL153C
Alias PFD4
Description Subunit of the heterohexameric cochaperone prefoldin complex which binds specifically to cytosolic chaperonin and transfers target proteins to it
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GIM3	6324176 upstream sequence, from -1000 to -1, size 1000
GTGTTTGATATAGCAGTATCATTAGTTTCTAATGTAGACGTTGTACCCATGGATGCTGAA
AAAGTTGGAGGTAAAATTATTGGGTCATTACTATTTGCCAATACCGCTGTATCTGATTTA
GATGACATGGAGAAAACATTGCCATTTCTGTAGGGCTGTCCCTCATCCTTATCCTCGTGA
CTTGTGCTAACACACTGGGGAGTAATCTGTCTCATCGTAGAACCATGAACATAGTCATAC
TCTGATTCTGTTGGCAATGGTGGTATCGGCCTCATAGCCATAGATGAATCCAACCTGTCC
ATTTCTTTGTTAAGATCGTCCCTGTTTAAACGAGGTACTTTGGGAGTGAAAGTCAACTCA
ATGAATATAGTGCCAGCAAATTCATCCCCACTTCTTTTCAGTTCGTACCAGGTACAATAA
CCCTCCTTCGGGTCTGCTCTAATAGCATTTAAAAGGTCTATTTCACATCTTCCAATTGGC
AGCGGAGATTTTTTCCTTCTATCGCAGTAAACTTCGACGTACATTAAAGGCTTTATCTCT
GGAGTAATATCAAATTTTTCTAAATAATGGAAAACAGGGTTTTGACCTGCTCGATGTAGA
GTGTTGCTGGCTCTTGTCATATGAGCTATTCGCAACCTAAGCATTACATTTTGCTTGTCC
AGTTTATTCAAATTAGGCAAGTCTCTAGCTTTGCTCACATATACGGAGAGGATTCCTTGG
TTTCCATTCCATACTTCTTCGGACATTCGACAGTGACTCAACGAGTTAACCCAATTCCAG
TTGTGAAACCTAAGGTCTCCGAATTCTCTCGTACTATTAACATACCTTTCTATGTTTTTA
TCTAAATCATATGAGGAACGCTAGGCCGTCATTCATGATCAGCAGAGGCGGCTTTTCATA
CAATTTTACAGGAAGCTAAGTACTTAGAGGACTTATGCTCTGTTTGGTCCTGCGGAAACT
ACCAGAATACACAACGCCAAGAAACTAACAGAGGACCATT
Chromosomal Coordinates Chr XIV from 346058-345669
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator