Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPS7b
Systematic Name YNL096C
Description Protein component of the small (40S) ribosomal subunit, nearly identical to Rps7Ap; interacts with Kti11p; deletion causes hypersensitivity to zymocin; has similarity to rat S7 and Xenopus S8 ribosomal proteins
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS7B	6324233 upstream sequence, from -1000 to -1, size 1000
GTGCCGCATGTGTTCCATTTGGGTTGATATTATTAGGAGCAACTTTAGGAAGATTAAAGA
TTGGCAACCTTTATCCTGGATTTTGGAAAGCCGCTGTGACACTCGTCATTTTGAGACAAT
GTGTCATGCCAATTTTTGGTGTCCTATGGTGTGATCGGTTAGTGAAAGCTGGATGGGTTA
ATTGGCAAGATGATAGAATGCTACTATTTGTTATAGCAATCAGCTGGAACTTGCCAACGA
TGACTACCCTTATATATTTCACCGCCAGTTTTACGCCGCCAGAAACAACTGCGCCAATCC
AAATGGAGTGTGTTTCATTTTTCTTAATGCTGCAATACCCGCTAATGGTTGTTAGCTTGC
CATTTTTAGTGTCTTACTTTCTGAAAGTACAGATGAACCTTTAGTTTTAATCCATTAAAC
AAAAAATTATTACCACTCCTAATCACTGTTTTAGGGTGGGTTAAAATTAACATTCTCCAT
TTTTATATAGAACTAATAAAAAACACCTACTTATAGACACGACCAAACTTTCCACAACCT
TTCATCAGAGAGAAATGTTGATCAAGTTGAATGCGTGAAAGTAGCAATTCGAAACAACAA
CTACCTGTCATTCTGCATAGTAGTAGTTACGAAAGGCACAGAAAATAACAAAAAAAAAAA
AAAAGTCAATTTTCTACGGTCTCCATCCGTACCTCTTTAAATCCGTACATTATTGTTTTG
CTTAATTTCAATATTTCGGAAAAAGCGAGCGCCCTGGTAAAATGTGGTTCAAGCCTGCGA
GCCTTTGCTTGGTAACTCACCAAATGCAATTCAGTCACGTTCCACACAGTTTGGGTTTCC
AGCCTGGCTTTAGGGAAGAATGGGCTCACTAGGCGTTCATAATACGCGGAGGGGGAAATA
CCAAATGCTATTGATTATGGTTAAAATATGTGTTATTTGACTTTGTATATACAAACAGAA
GAGAAACCAACACACTAAAGACTAGACACATAACTGACCA
Chromosomal Coordinates Chr XIV from 443826-443398,444315-444172
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator