Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RLP7
Systematic Name YNL002C
Alias RPL7
Description Nucleolar protein with similarity to large ribosomal subunit L7 proteins; constituent of 66S pre-ribosomal particles; plays an essential role in processing of precursors to the large ribosomal subunit RNAs
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RLP7	6324326 upstream sequence, from -1000 to -1, size 1000
CTGGAAAATTTTGTCCATTAATATCTTAGCGTAGAAACCTGGAGAGCAAAGAATAATAGT
CTTTAATTTATCAAAATTCAAATCTTTCTTCATTGCACTGTAAATTGCTTTATAAAATTT
CTCAGTTTTTTCATCAAACTTCAGTACATCAGTAGTCCTTTTCTTTTTTGGCATACTATA
TTCAATTTTTTGTTTTAAAATAGTAGAGGAGGATGTCACTAAACAAACATGGGCGATCCC
TTCCTGTAAAACGACCGCCGCGGTGTCTGATTTATACTCGATATTACAGGCTTCATTTAA
GAGCTTTTGCATGAATTTATTAAAGTTTTGTTTTATGATAGTAAAGGGATACACGTAGTC
AAGGGTAAAGCTCAAATATTTGCCGACAGGTATGTCAACATTACTAGCTCCACTTTCATC
TGTAACAGTAACACCTTTATATTTCAAATATTCATCCTTCATATCAAAATCCTCGGATAT
TACTTTAATCTTCAACTTGACCAAATCTGTACTTTTTTTCTTACCAGCTTCATCAAGTTT
AGAGGTGAATTTTTTCTTGAATATCAACTCGTCATCTTTGTCTACTATTTGATAAACAGT
AAACAGATCTTCCTTGTCCTCCGGTAAAAGAGTAATCACTGCTCCTCCTTTGTTAAAAGA
ATCCTTTTTCAGACTAATAACCTTCATATTTTTGCTATGATAGGAATGCGATAATTGAAC
AAAATGACAACGATGCAGCAACGAATGCTTAATTTTTTGGGATCTTCATTAAATTACATT
TTACATTAATATACAAAACTAGGTGAATATTGAATAATGTATGTACACTTTCATCACGCA
GTACGGATTTTTGGTAAAAAGAAAATTTTTTTCAGCTCTGCTTAAAAAAAGCTGGGAAGC
GATGAGATGAGAAAAGTCTAAGTTGTTTGGTACTTTCGTTATTAAGTTCCTAGAAAGAAG
AGGCTGCCACAGGGAAAAAGAATAAGATATACAAGTCACA
Chromosomal Coordinates Chr XIV from 627142-626174
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator