Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ADH6
Systematic Name YMR318C
Alias ADHVI
Description NADPH-dependent medium chain alcohol dehydrogenase with broad substrate specificity; member of the cinnamyl family of alcohol dehydrogenases; may be involved in fusel alcohol synthesis or in aldehyde tolerance
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ADH6	6323980 upstream sequence, from -1000 to -1, size 1000
CCATGGAGTGTTCTTGTATCCGTCATCATCATCATTGGTTTAATTTGTATTGCTTCCGGT
TTGCGTTGGAGTACAACAGGTCAATTGATTGCTAACACGCCAACTATGATTATCGAAGAA
TTTTTCTTGCTAGTTTTGTTGCAAGCACATAATTGGGCCGATCGTCAAAGAAGAGTGGAG
GTTACCGCTTTGTACGCACGTAGGCGCATACTTCTATCATACGTAGAAAAGCGTTTCCCA
GAGGTTATGATGTTGGAAAAATAGCTTCATTGAACATTTTAGCATTAGTGGGAAGAATTC
CTCATGTTACTTATGAGGGAGTTAATTTTCCTTAGGGATTTTAGGAATTTCTATACGGAG
GTAGCGATCGACCTTAGAACTTTTATTTAGTTTGTACATATACCTCACCTGAGTTTTGCT
TTTTTCTCTGGGAGCCTAAACCATTTAAAATGATATATAATAGATAATAAATCCAGGATA
AAATGTGGCTAATTGATCTTTTTTCATTTTCAACTTGGTAATGACGTACTGGATACTTTC
GACGCTCTTTTTTAGTCCCCGATCCCCGTCTTCCAGGACCTTGACGTGGAATTCCGATCA
CAGCCACTCTCGTCACGGCTCCGTTAAAATGAATGGTTTTCCGTTACATTTACTGGTCTT
TTTATCTTTTTACAGTAAATGGGTGATATACTGTGACACAATTTGTGTCTCTACTGTGTG
AACTTCCATTGCTGACTAAAGATTCCCCGCTCCGCTTATATGTCCGGTCCGTCCTTGACC
GAAGATCACATTGCCAATTTTTCACATCTGGAAGCGATACGACAATATAGGAGAAAAAGA
AAAGTGAAAGGCAAAAAAGCACCAACAGTTCTCGAGGTGAAGTGCCGTCAATCTTCTGTA
TAAATTCGGCCAATTCAATCTAATTTAATAGATTTGCGACAGACTTTCACATCCACATTC
GAGGAAGAAATTCAACACAACAACAAGAAAAGCCAAAATC
Chromosomal Coordinates Chr XIII from 912143-911061
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator