Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ADE4
Systematic Name YMR300C
Description Phosphoribosylpyrophosphate amidotransferase (PRPPAT; amidophosphoribosyltransferase), catalyzes first step of the 'de novo' purine nucleotide biosynthetic pathway
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ADE4	6323958 upstream sequence, from -1000 to -1, size 1000
GGTGTGGTACCACAGGACACACCACTTTTCAATGACACTATCTGGGAAAATGTAAAGTTC
GGTCGTATTGACGCAACCGACGAGGAAGTGATAACTGTAGTTGAAAAAGCCCAGCTAGCA
CCCTTAATCAAGAAATTACCACAAGGTTTTGACACCATCGTCGGGGAGCGAGGGTTGATG
ATCAGCGGTGGTGAAAAGCAAAGGCTGGCAATTGCAAGGGTACTATTGAAGAATGCAAGG
ATCATGTTTTTTGACGAGGCCACAAGCGCCTTGGACACACACACAGAACAAGCTCTCTTA
CGAACCATTAGAGATAACTTTACTTCGGGTTCGAGAACGAGTGTATACATCGCACATAGA
CTGAGGACAATTGCAGATGCAGACAAGATCATAGTCCTTGACAACGGAAGAGTAAGAGAG
GAAGGTAAGCATCTTGAACTGTTGGCTATGCCAGGGTCATTGTACCGCGAACTTTGGACC
ATACAAGAAGATCTGGATCATTTAGAGAATGAACTAAAAGACCAGCAAGAACTATGAACG
CTCGTAAGTAAATATTGATTTATACATGTATAAGTTTTTCAAGATTTAAGGAAAAAAGAA
AAGTTATTATCTTTCTCCGCGGTTTTTCAATGACCCGATGTATTGACTCTTCCTGACCGA
AAATAACAGGACAGAGTTAGAACGAACATGAATAATAAAATATAATCTGGGATCATGAAT
CCGAATGACTGCTCATGCGGCAAATGTCAGAGCTTCGGTGTATTTAAAGTTTGCTTACTT
ACAATTTCAATAATAGGTTTGTACTTTTCAGATTCTTATTATTAAGTCAAGGTAAAGTCC
TTCGTTTTTTTTTTTTTCATTTTAGAAAAATTTCAACAGCCACCGTACAATTTTATTCAC
TTTTAAGTCATAGTTGCGAAGACATCGTCTTGAAAGTAGTAGATTTCGTTCTAATAAGTT
TAGCAAAGAAAGAGGTACAGCAAACAGCAGAATAGAAAAA
Chromosomal Coordinates Chr XIII from 867091-865559
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator