Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name LCB1
Systematic Name YMR296C
Alias END8, TSC2
Description Component of serine palmitoyltransferase, responsible along with Lcb2p for the first committed step in sphingolipid synthesis, which is the condensation of serine with palmitoyl-CoA to form 3-ketosphinganine
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LCB1	6323954 upstream sequence, from -1000 to -1, size 1000
AGAAACAATCTCTAGTGAGTATTCTTTCTCTCTCTCTCTCTTGTCTTGTTAAGACTAGGA
GGGAAGACGAAAAGAATTATTTCGGAGCTTTTTTGCTGGCATTCTTATCTCGTGCTTTTA
TTAGTGGGCCCCTTCTTTGAGACCCCGCGGGTGATATGGCCCCTGTCTCAATGATGGATA
AAGTTGTTGGAAGCAATTACCAAGACAATCACAAACGAAGGTTGCTACCGAAGTGTACTG
GATGACCAACATCGCTATGATTAAATAAGACTATACATAATAGACAAGGGTGGCGCGGCT
CCATTCCCAGGGAGACACAAACACGAGGTAAGTCTCAAAAAACCGAAGTTTCGCTCTAAA
ACTGCACGTAAAGGTCGTGGTATTGACTACAACCATTGACTGTTACATTGTGTAGAAGAA
AGGTCCTCACATACTGCTCTGTCAATATGGCTTCTTGTGCAGAAGGTCAATATGTACTAT
TTCCATGAACCCACAAAATAAGGGAAAAAAAACACTGGAAATAACCGCCACACATACCGT
ATAAAAGTACATCTCTTTATACGAGTTACTTACTAGACCCTAACCAATGCCTTCAAAAAA
CAGGACAGACCCTAAAAACTACCATAAGAGACCTAACATATGTATCATCATATACGGAAA
TCGATTTCGCGTATTTTTTTTTTTTTGAGGCGCCATGATTTCTTACACGGTTTCTTTTTT
TTTTCCTTCTTTCCTTCTTGCTTCTCTGCTAACAAATTTTTCACTCATTCTTTTTTATAG
GGGCATATTGCTGCGGTTAACTGTAGTGAACGAAAGTAAGATTGAGAAAATATAGTACTT
AAGAAAAAGAAAAGGAAAAATAAAAAAAATTCTTTTCAACATCATCGAGTAGCACAGTAT
AAGAGCGCTCTAACCTTCTGCCTGGCCTCCAATATACACATTTTGCTCGTGTAGGGTTAT
TTATCCTTTTTTCTTCCTTCCCACCCAAAAAAAAAAAGCA
Chromosomal Coordinates Chr XIII from 860891-859215
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator