Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name YKU70
Systematic Name YMR284W
Alias HDF1, KU70, NES24
Description Subunit of the telomeric Ku complex (Yku70p-Yku80p), involved in telomere length maintenance, structure and telomere position effect; relocates to sites of double-strand cleavage to promote nonhomologous end joining during DSB repair
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YKU70	6323940 upstream sequence, from -1000 to -1, size 1000
GGCCATAAGTTTGAAATTTGTGTATACAGGTATAGGAAACCCTTATACCTACCTAAATCG
TCGAAGCTACTGATATATTGCGTATAGTCGATATGCCCAATGTAATTCATATTTCATACT
CTTCTCTTGTACAGATTAAGGGCACCTGTTTTATTCTTAGAATATACTACAACCTGCCTA
CTAATTAACAATGATACTATTAACGGTGCAAAACCGGATGCTCAAATTTAAAGTGATTAC
TCAGTTATAAACACGCCTGGTGTGAAATTAACGACCATTAATAAGAATAAATATTACTGG
CATATTATAATATGCGGTGGAAAAACATAAAATAAGGATTGAGAAATAGTTATCAAGTAT
AATGGAAGCTGAAGTGCAAGGATTGATAATGTAATAGGATAATGAAACATATAAACGGAA
TGAGGAATAATCGTAATTTTATTATGTAGAAATATAGATTCCATTTTGAGATTTCTATCC
TCGAGGAGAACTTCTAATATATTCTGTGTACATAATATTATATAGCCTTGATCAACAATG
CAATCCCAACAATTATCAAATTATTCACCCAATATTCAGTATAATCCATATTTATAGAAT
ATATAGGATAATTATCATCCCCTCAATCAAGTTGATATTCCGTTTTGACAACAGGTCACT
TCTGCAAGGTTGCTTATATTAAAATTGTGAATAAGCATGATATTAGACGGACTCATAATT
GAATGGTTATCAGTTAATTGACTCTCGGTAGCCAAGTTGGTTTAAGGCGCAAGACTGTAA
TTTACCACTACGAAATCTTGAGATCGGGCGTTCGACTCGCCCCCGGGAGATATTTTTTTA
CTTTTGATTACCTTAATTTTTGAAGATTCTCAATTTCATGTATTAGGGATTGCTTTAAGG
TAGCTACCAAATGACATTCTCTGTATTACTGTTCTAGTTTTCAACAGTAAAGCTATGATT
TGTTAAGTGACTCTAAGCCTGATTTTAAAACGGGAATATT
Chromosomal Coordinates Chr XIII from 838187-839995
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator