Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SCS7
Systematic Name YMR272C
Alias FAH1
Description Sphingolipid alpha-hydroxylase, functions in the alpha-hydroxylation of sphingolipid-associated very long chain fatty acids, has both cytochrome b5-like and hydroxylase/desaturase domains, not essential for growth
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SCS7	6323928 upstream sequence, from -1000 to -1, size 1000
ACCAACAACACTCCAAACACGTCCAAAAGGAGAATACCGATGAGCAAAAAGCTCAACTAC
AAGCTCCAGCTCAAGAACAAGTCCAAACTTCAGTCCCAGTTCAAGCTTCAGCCCCAGTCC
AAAATTCAGCCCCAGTCCAAACTTCAGCCCCAGTTGAAGCTTCAGCTCAAACTCAGGCTC
CAGCGGCACCACCATTGAAACATACCTCCATATTGCCCCCAAGAAAGCTTACATTTGCAG
ACGTCAAAAAACCTGACAAACCAAACTCCCCGGTTCAATTCACAGACAGTGCCTTTGGGT
TCCCACTGCCTTTGCTGACAGTGTCTACGGTTATCATGTTCGACCACCGTCTACCAATTA
ACGTCGAAAGGGCCATATACCGGCTGAGTCACTTGAAATTGAGCAATTCGAAGAGGGGAC
TGCGCGAGCAGGTATTACTAAGTAACTTCATGTATGCTTATCTGAACTTGGTTAATCACA
CTCTGTACATGGAGCAGGTAGCCCACGACAAAGAACAACAACAACAACAACAACAACAAC
CCTGAAAAGGCTTCAGCGCTGCATACATAGACATATACACATCACACGTACATACACGAA
AAGATAGCTTTCATGCTCACAAAGCTACGTTCCCCACAGAATATTTCCCAGGACAACAGG
GAAAGTTGGACAAACACCAAACTTCTCATAATACAATAGCCGAAAACAGTCTTGCTTTTG
ATAAAGAGAGCTTTCTGCGGCCGGAAGAAAATGTGCCTATTCCGCGGGGCCGTTCCGCGC
AGAAACTACCGCACGACGTCGGAAATATAACGGGGTTTTGCGCGGATTTACTGACGTGTG
ACATCTTTTCGCAGTTAATTTTTTTTTCAATTTGGAACCGTATAAGAACAGAGGTATTAG
ATAGTAGAAGCTATTGTGTCTATTGTCTTTGATTAGTTTTTTTTTCTATTGTTATCGTGG
CAGGCACTAAAAGCGGTGGTAAGCTAAAACTAGTACGAAG
Chromosomal Coordinates Chr XIII from 810777-809623
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator