Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TAF7
Systematic Name YMR227C
Alias TAF67
Description TFIID subunit (67 kDa), involved in RNA polymerase II transcription initiation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TAF7	6323883 upstream sequence, from -1000 to -1, size 1000
AATCGAAGTCAATTGGGTCCATTTCTACTAACGCAATTGGCTTTCCCTTTGTAGGCCATA
TTTCCGCAGCACTAAATAAAATGGGATCCCATTCTTCTATGCATTGACTATCAAATCCCT
TCAATTCATTTGCGTCTGATATGGCAATGAGTTTAGTATCTGTAAATGCCTCCCTTACTA
CTGAACATTTGGATCTAGAATGCATGCCTGGCCTAGCTAGAAGTTTTCTAGCTGTTGTGC
TTGGCATCCATAATAACATCTTTACTTTACCAAACCTATACAACCAGTTCTTGTTTCCAA
TACAGGACAGCCACTGCATTATAAGACCTTCAGAACCCTCCCCCGTCACATTAGCAACGG
TTAGAAATTTATCATTAATATGATCTGAGGATTGAACTTCAGGAACAAATATTCGCTCTT
CGTCAATTAGATTCGAGTAGGTTGACCAGTCATATGGATCTCTTTTTAGAATTTGCAATG
GAGACCCTTCGAATTTTGCATTCAGAAACTTGTAGAGACTTGAGCGTTTTTCTAATAAAG
AATATTGCCTGGGGCAATATTTATTATAAAAAATAGCTGATTGTATACCAACACCAGGGT
AGAGGTCAAGTACTTTCAATTCTTCTGGATGTTTATACGTTTTAGTTAAATCCAGCTTAT
CAAAGATTTTATTGTATACTGTTGGATTCCATAAATATTTGAAACCATAAAAGAACTTAA
GTTTGGAGATATCTTTAATACCAGGGATTGGAACAGACATAGTTGCTGAGCCTTCTTACT
TCAAAGAATGGTATTGACTGACGTAGTAACCGCATTTGTAAAGTTTCATCTCTATTATCA
TCATACAATAATATCGCTGTTATTCGGCCGATGAGAACAGTAAATAAAATTTCAAGACAA
AACTTGCTAGCAAAAATAATAAAAGCGAGAAGAATAGGAAGAACTACATAAACAAGAGAC
AGTGTTACCATTCAAATTAGTCGCAATAATCGACGTAAAT
Chromosomal Coordinates Chr XIII from 724385-722613
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator