Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPL36a
Systematic Name YMR194W
Alias RPL39B
Description N-terminally acetylated protein component of the large (60S) ribosomal subunit, nearly identical to Rpl36Bp and has similarity to rat L36 ribosomal protein; binds to 5.8 S rRNA
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL36A	6323848 upstream sequence, from -1000 to -1, size 1000
ACTACCAAGTTGGTGATGCTAAACCTTTACATATGCCAAAAGAAAGAAAGAAATTTCCAG
ATTACAAGTATGGGGAATCTAATATCTTCAAACAGAGTAACAAAGGTCTATATGGTGGAT
CTTTCGTTCAGTTTGGTAACAATATTTCTGAAAGTAAAGCCAAAACGAGGAAGAAGTGGT
TGCCAAATGTTGTCAAAAAAGGTCTCTGGAGTGAGACTCTGAACAGAAAAATCAGTATCA
AAATGACCGCTAAAGTTTTAAAAACAATCAGTAAAGAAGGAGGGATTGACAACTATTTAA
CAAAGGAAAAATCTGCAAGAATAAAAGAATTAGGGCCGACCGGATGGAAGCTTCGTTATA
GGGTTTTAAAAAGAAAAGATGAAATAGAGAATCCCCCACATAAGGATGCACCTATCATAG
AAATGGCTGGTGGTAAAAAGGCCAAAATTTACTATGATGAAATAGTAAACGGCTCACCAA
GAAAAATATCAGTTGGAAGAAGAAGATTGATGTCATTTTTATATCCTTTAGAGAAATTGG
AATATAGGTCAGTAGGGAAGGACCTGAACTACAAAAAATTTGTCGAGTTATTTGCCGACG
TTCCAGTCAAGGATATCCTAGCTAGATTAGAGGATCATAAATTCGACTTATCCACCATCA
CCGTATAAAAGGAAGAAATAAAGAAGATAATTGCCATTCCGAAAATATCGTTGGTTTTCC
CCTGTATATAAAAAAGCATATCTGTTTGTACATATGTAGGTATGCACACATTCTGAACAT
TATTGATGCGTATATGCTTGCTACATTAATTGGCAATTCATTTTTTAGACTGTTTTACAC
CCGTACATTTCACAGTTTTTTTTTGAAGTTAAATTCCAACTGAATGGAAGCCTCCGCTCC
TATGAAATTTATTTGAAATCAGAGATTTCAGGATGTTGAACAGTATAGTACTGATTTACA
AGTATCAAAGAAACAAGAAAGACAGCAAACACAATAAGAA
Chromosomal Coordinates Chr XIII from 651145-651160,651624-651910
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator