Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ATG16
Systematic Name YMR159C
Alias APG15, APG16, CVT11, SAP18
Description Conserved protein that interacts with Atg12p-Atg5p conjugates to form Atg12p-Atg5p-Atg16p multimers, which localize to the pre-autophagosomal structure and are required for autophagy
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>APG16	6323811 upstream sequence, from -1000 to -1, size 1000
TGAGGTTGTTCTTGCGCTAGATTTTGTGACAATTTTCTAGAAAGATAATAAGCCGATCTT
TGTGATTCTAATGAGCGCTGCTCATACTTTTCTGGTAAATCCCCCACGACGGATATTATA
ATAATTCTCTTATCCTTCAGTAATGCGGTTTTTTTTTGTCTTAAATAGAGATGTTGCTCA
TTAGGGAAGTTATAGTAATTTTTGATAGTATTCAATACCTTAGTTCTTAGTGGTTGGACG
TGCAGAAAATTCAAAGGGTTATCTGATGGTAGGATTAAAGAATCATTAATAAATACATTA
TACCCAGGGTTACCTCCCTCCCCAGGATATTTGTTTAATGGCAATGGGCATTTGGCTGAT
CCTGTACCAGAGACACTGATTATTCCTGGGGTATCTATGGAATCAATTATGTTTGATGAA
TTTGATATATGTGGAATTGCTTCGTACCAACACCATGATTTCGACTTTTTTGAAATTATA
TCCTTAGCCTCATTTTCCAAGAAGTTGATTTGTTCAGTGTTTAGTTGAGAGTAGCGGGTA
TTATCATCAACAACAATTGGGGCACTTCTATATCTGGATGTTGCAAAAGAAGCGATTTTA
GACCATATCCCTTTATTGTCATTATTCGAGTTCACGCTATCTTGAAAATCCGTTGTCGGA
CTACTCCTTCCTTGTCCATTAGGATATTCTGCAATTCTTCCCGTGTTTGGCTCATCGTCG
GCAGTGGAATTCCACCAGGGTTTCCATCTGTTTTGTTGTCGTGGACGTTGGGGTGGGACT
TCCTGCTGGTCCTCTCGTATCTGCTGCTGCTCTTGTGTTTGATGCTGCAACTGTTTATCC
TGTTTCTGCTGCACAACATCCATTATAATAGCGTTTTATATGTTGTGCTAAATTGCTACT
ACACTTGCTCGCTTTTACTTATTCTGTTTGTAGTTGACCTTTATTTAACGTTGATTTTTG
TTATTAACCTGCGCGAATCTGTATTAAGGGCGCATATTCC
Chromosomal Coordinates Chr XIII from 574928-574476
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator