Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPL13b
Systematic Name YMR142C
Description Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl13Ap; not essential for viability; has similarity to rat L13 ribosomal protein
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL13B	6323791 upstream sequence, from -1000 to -1, size 1000
TGTACAATCGTACTGGTTACGGAACTGACCGTAGTAGTTTAACCAATCTTGTCAAAATAC
TCTCCCCAAAACATTGCCTAATTGGATCTCAATTCGGCTTGTAAAAATAACAATTCTTTC
CTTTGGATAAATACACTATGCGTACTCATTTACTGCCTACTCAGAACTTGGTTGGCTGAC
ATATTCATTTTTTTTCTCTTGATCTCACTCCATTATCGATACTATCAAACATCATTCTGC
AGAACTGAAAACATACTTGAACACTTGGGACAGCTGACATCTTGGGATTCTTCTCTTGTA
TACTTTACTATCTACCTTTATTTATGAGGCTTCCTTTACAGAGTTCAGAATTTGTAGGCT
ATTTTTATGTATATCCTTGCCCTCTCAGTTGTTGCAGCGAGTTCACGATAGTTTGCGCTA
AGCGGTAACTCTTGGAATTCCAGCAAACTGCCAATCGTCCGCTGTGCTAAACTGGACGGG
AGTCAAGGAAAATCAAGCGTCAATTACTTTTCTTACCAGGCCGCCAACAATTTTTATATA
CGGCCTTAGCATTTTCCATTTCCGAGATGATTTTATAATGTATGGGTGCCAATATGTACT
GATGTTTAAGTAATACGGTGAGATTATCTTGAAAAAGATTTTCAGTGCCATAAAATCTGT
ACATTACGCACCCATACATTTATAGTTTTTAAAAAAATACTGTATCATCCCGGACGCACG
TTCGCGAGTGTAATCTTTTGCCTTGCGTAGGCTTCCATCTCATCCACTGGCCTCGCTAGA
GGAATCTCTAGTGGGGTCATTCGACTTCTTGGTACGCTCTCCTCAGGCTGACGCGGCATT
GCAAGGACACATTACTAACCTACTCGGAGCCGGTGCTCACCATCCTCCATTGGGAAGTTA
CTTTCTTACATACTATGTAATTAGAGGTACTTGAAGTTAGAACATAATGTAACATTAATA
GGAAATAATTTCGGAAAAGTAAAGCAGGAATCAAGTAACA
Chromosomal Coordinates Chr XIII from 550801-550206,551207-551204
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator