Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MYO5
Systematic Name YMR109W
Alias myosin 5
Description One of two type I myosins; contains proline-rich tail homology 2 (TH2) and SH3 domains; MYO5 deletion has little effect on growth, but myo3 myo5 double deletion causes severe defects in growth and actin cytoskeleton organization
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MYO5	6323756 upstream sequence, from -1000 to -1, size 1000
ATGTGGGCTGCTCAACACTGGACATGGAGAAATCCACATACTTTCATCACATCAGGTGGT
TTAGGTACGATGGGTTACGGTCTCCCTGCCGCCATCGGTGCTCAAGTTGCAAAGCCAGAA
TCTTTGGTTATTGACATTGATGGTGACGCATCCTTTAACATGACTCTAACGGAATTGAGT
TCTGCCGTTCAAGCTGGTACTCCAGTGAAGATTTTGATTTTGAACAATGAAGAGCAAGGT
ATGGTTACTCAATGGCAATCCCTGTTCTACGAACATCGTTATTCCCACACACATCAATTG
AACCCTGATTTCATAAAACTAGCGGAGGCTATGGGTTTAAAAGGTTTAAGAGTCAAGAAG
CAAGAGGAATTGGACGCTAAGTTGAAAGAATTCGTTTCTACCAAGGGCCCAGTTTTGCTT
GAAGTGGAAGTTGATAAAAAAGTTCCTGTTTTGCCAATGGTGGCAGGTGGTAGCGGTCTA
GACGAGTTCATAAATTTTGACCCAGAAGTTGAAAGACAACAGACTGAATTACGTCATAAG
CGTACAGGCGGTAAGCACTGAATTTCAAAAACATTTATTTCAAAAGCATTTTCAGTAAAA
AATGCAGACTTTATTATTATTTAATCGTGCTTCTTATATATGACATTCTACCAAATCGGT
AGTCATGTATATTTTTTTCGTATATACTTTATATATTTTTTTCTAAAAAACTAATGACGG
CTAAAATTAAGTCATAGATGAATAATAAGTTCAATTCAAGTGAGTTGGTAGTATTTGATA
AATCTAAAGTGGATACGTAGCATATGTATTCAAATGGTGTGTTTTAACTCGTCGGACACG
ACTTCTTTCTCGTTTTGTCAATCATCAAAAATATTTCTCGAAAAGGGGCCGTCAAAAATT
GCAAGCTTGGAAAATACAAACTGGACTATGTATTTAAAGGTTATAGTTTATAATAAAGCA
TAAGAACAGTGGCCAATACGAATTTAACCGCTTTATAGAA
Chromosomal Coordinates Chr XIII from 486587-490246
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator