Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name IOC4
Systematic Name YMR044W
Description Member of a complex (Isw1b) with Isw1p and Ioc2p that exhibits nucleosome-stimulated ATPase activity and acts within coding regions to coordinate transcription elongation with termination and processing, contains a PWWP motif
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IOC4	6323687 upstream sequence, from -1000 to -1, size 1000
CCTAATCAAAACTCAATGATTCAACAGCAGCAACATCACACGCAGAATTCACAACCACAA
CAGCAACAGCAACAACAACCACAGCAGCAAATGTCACAGCAACAAATGTCACAGCATCCT
CGACCACAGCAAGGAATACCACATCCGCAACAATCGCAGCCACAGCAACAGCAACAACAA
CAACAACAACTGCAACAGCAGCAACAGCAGCAACAACAACAACCCCTCACCGGCATTCAT
CAGCCTCACCAACAGGCTTTTGCCAACGCTGCCTCCCCCTATCTGAATGCTGAACAGAAT
GCTGCCTACCAACAATACTTTCAAGAACCGCAACAAGGCCAATACTAATCTTATCGATTT
CCGTATATAATTCATAGACGAGCATTAAGAGGAAAAAGCTGTTTCCGTACCAATTAAAGA
AAGATAGACAACAAGAACAAAAACGTACATTACTCTATATTGAAAAAAGCCCTATGTCGG
TAAAAGAATAGGAAGTACCTTAGTCATCGGCACTTACCTTTTTTTTTACGATTACTTCTG
GTTTGTTTCTTTGCCTCATTTCATTTTGCTGCCACTTTCTTTCATAGGCAAGAAGATTCA
ATCAAATCTCCCCTTCTCCTTCCCCGGATATATAAAATATAAATATAAAACTTTAAGAAT
ATAAAAATATGAGAAACCACACATAACTTGTATACTTTACTCACATACACACATTTCCAA
AAAAATTATAATGTTAATTACATTGCTTTTAATGCTAATCTTTTTTTAGTTGTATAATCA
TTACCATATAAATGCCTCTCGGTCTAATTTCATTGCCAGTATTGTAAGTTATATACTTTT
ATACGAGTGTACGGAAAATATCGTGGCTCCCCGTTAACAGTGAAATAAATCTACGCATGT
AGCTGCCAGTTTTTTAAGCGTTATATCAATATTGGTAAAGTAAGAATTGACGAAGAAATT
GTTAACTACATTTTTCAGAACGGCGTGTCATTCTCCGATA
Chromosomal Coordinates Chr XIII from 355384-356811
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator