Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TUB3
Systematic Name YML124C
Description Alpha-tubulin; associates with beta-tubulin (Tub2p) to form tubulin dimer, which polymerizes to form microtubules; expressed at lower level than Tub1p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TUB3	6323511 upstream sequence, from -1000 to -1, size 1000
AAACCATCGGTTATGCCGGTTCCAAAAACGTTTACAAGAAACTGTATGATACTGCTGTCG
GTAATCTGATTTTGATTTGTGCTGGTTCATTACCTGGTTACTGGGTATCCGTCTTCACTG
TCGATATAATCGGTAGAAAACCAATTCAATTAGCCGGTTTCATCATCTTGACCGCTTTGT
TCTGTGTCATCGGTTTCGCATACCATAAACTTGGTGACCATGGTCTGTTGGCTCTTTACG
TCATTTGTCAATTCTTCCAAAACTTCGGTCCAAACACAACCACCTTTATTGTTCCTGGTG
AGTGTTTCCCAACTCGTTACAGATCTACTGCTCATGGTATTTCTGCTGCATCTGGTAAGG
TCGGTGCCATTATTGCACAAACCGCTTTGGGTACTCTAATCGACCATAACTGTGCTAGAG
ACGGTAAGCCAACCAACTGTTGGTTACCTCACGTCATGGAAATTTTCGCCTTATTCATGT
TGTTGGGTATCTTCACAACCTTGTTGATCCCAGAAACTAAGAGAAAGACTCTAGAAGAAA
TTAACGAGCTATACCACGATGAAATCGATCCTGCTACGCTAAACTTCAGAAACAAGAATA
ATGACATTGAATCTTCCAGCCCATCTCAACTTCAACATGAAGCATAAAAGCCTCAAAGAT
GCACTAAAACTTGTAAACTAGAACAAATAATACAAAAACATTTTTATAAACTTATTATCA
AACCCCTTACATAATCTATAAATACTGTCAGGTTACATATTTATTCGATAATTTCTTTTA
ATTTCATTATTTCCTCACATCTCTCTGCCATCCTGTTGGCTGGTGCCAGAGCAGAGCATA
TCGTCCTTTCTTTTTTAGTTCCAGACGTTACCCGACATATCATTTCTCGAGCCTCTGGAA
ACCACGAAACGTTTTACAAATTGCACATCTAAAAGAAATATAAACACAGATCAGGTATCT
CATAAAGTACATTAATCGACTAAGCAAGCGACTTGAGACA
Chromosomal Coordinates Chr XIII from 23360-22048,23683-23659
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator