Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name Uncharacterized
Systematic Name YML090W
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the dubious ORF YML089C; exhibits growth defect on a non-fermentable (respiratory) carbon source
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YML090W	6323549 upstream sequence, from -1000 to -1, size 1000
CTAAAAGGTTATAGTCGAGAACATCTTTGGAAAAATTGCGAAACTTAACCACACTTTTTT
GCTTTGGATCGTTGGTGGTCGTATTGAATAATTCAATGGCAATTTTGTAAAAATCACTAC
CGTTTGGATTTTCGAACTGATAGGCCAAAATTGAGCCCTTGAAAAGAGACAATAGTACAA
TATTATAAATCTCATCAGGAGGTTTTAATCTATTGTTGATCATATCTTGGTAGCACGTCA
AGAGTTCGTACATTTTGTTGTCTAAATCATTGTTATCTAGCGGCCTTTTGCAAAGAGAGT
CCAAAACCTTCGTAAATATTTCCAGTGGCGGAACGATATCATTTCTTTTCAATGATTGAT
ATAAAGAGTTGATTTTGTTATAATTTTTTTGTTCGTAACAACGATTAATTTCATCAATAT
GAGTTTGCAAGTATGTAGATTTATTCAGGCATGGTTCTGTGTCCTCCTTCCAAACTGGAG
CGTTTTCGTCTTTTAGAAGGCTGTACTCATTTTGTGGCTGTTGTACTGATGGTTGTGATG
TTTTTAATGATAGATCTTGGAAGTTCCTATTACTAAAGTTTAAGGGGTCATATTGGTTTG
TTGGTAATGTGGGGCCGGTAGAATAATACCTATGTTGATTGTTGTTGTTGTTATTAACAT
AGTTTGTACTTTGCTGCTGCTTCAGCGATCGAAGGGAAACGTTTTGGTTATAAAGTAGTT
CTTCGTGGGTGAGGGGGTTGTTAGTGTTGTTTATGCTAGAATCCAGGTCGTGCGGATGCA
AAATATCATCTACGTTGTTATAGTTTACATTCGCTACTACGACCGGATGAGGATGTAGAT
GAGATGCATGAAGTACGGGATCCGAATTTACCAAACCTTGGTTTTGCCTTAGATACTGGT
AGGAGCTATCGAAAAAAGATGTTGCAGTTTTCTTTTGAGCGGCGGAACGATGATAACCTT
TAGAGTATATGAATGATTTGAAAGCCATTTTCGTTTGTGT
Chromosomal Coordinates Chr XIII from 90744-91130
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator