Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name WAR1
Systematic Name YML076C
Description Homodimeric Zn2Cys6 zinc finger transcription factor; binds to a weak acid response element to induce transcription of PDR12 and FUN34, encoding an acid transporter and a putative ammonia transporter, respectively
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>WAR1	6323564 upstream sequence, from -1000 to -1, size 1000
CTGCCATCAACTGGATCGAAGGTCGTGGTAAGAGTGTCGTCGCAGAAGCTACTATTCCTG
GTGATGTTGTCAGAAAAGTGTTAAAAAGTGATGTTTCCGCATTGGTTGAGTTGAACATTG
CTAAGAATTTGGTTGGATCTGCAATGGCTGGGTCTGTTGGTGGATTTAACGCACATGCAG
CTAATTTAGTGACAGCTGTTTTCTTGGCATTAGGACAAGATCCTGCACAAAATGTTGAAA
GTTCCAACTGTATAACATTGATGAAAGAAGTGGACGGTGATTTGAGAATTTCCGTATCCA
TGCCATCCATCGAAGTAGGTACCATCGGTGGTGGTACTGTTCTAGAACCACAAGGTGCCA
TGTTGGACTTATTAGGTGTAAGAGGCCCGCATGCTACCGCTCCTGGTACCAACGCACGTC
AATTAGCAAGAATAGTTGCCTGTGCCGTCTTGGCAGGTGAATTATCCTTATGTGCTGCCC
TAGCAGCCGGCCATTTGGTTCAAAGTCATATGACCCACAACAGGAAACCTGCTGAACCAA
CAAAACCTAACAATTTGGACGCCACTGATATAAATCGTTTGAAAGATGGGTCCGTCACCT
GCATTAAATCCTAAACTTAGTCATACGTCATTGGTATTCTCTTGAAAAAGAAGCACAACA
GCACCATGTGTTACGTAAAATATTTACTTTATAGTTTGTACGTCATAATTTCTTCCATAT
TACAAGTTCGTGCATATATAGAAAGAATTCTGTTGTTGTAATTGTCATAACTATTGAGCT
TTACCTGAAAATTCAACGAAAAAAACTCAAAAACCACATGCTTCTCTTGAGTCATGCGGT
TCCTTTCCCTTATGAGTGAAAATCTTCCTTTTTTAGCTATGTGCGCCATCCGATAAATGT
AGGAGCAATGAAGCGGAAAGTCAATTTTTTCATACAGTATACATTAATATCTAGTGTGTA
TTGACTGTGATCGGGAAGATCTTCAGGGTTGAATTACAAC
Chromosomal Coordinates Chr XIII from 115347-112513
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator