Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPS1b
Systematic Name YML063W
Alias PLC2, RP10B
Description Ribosomal protein 10 (rp10) of the small (40S) subunit; nearly identical to Rps1Ap and has similarity to rat S3a ribosomal protein
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS1B	6323577 upstream sequence, from -1000 to -1, size 1000
GTGCCCACCAAAATAGGAATTGCCGAATCATTTAGCCCGTACGCCTGCCTATACCACTCC
TTTATTGAACTCAACGTCTCTGGACGTGTCAGGTCAAACAGAAATATGATCACTGAAGAC
CCTACCGTCGCAATTGGGAGCATGTTGATGAATTCTCTTTGTCCGCCTAAATCCATTATA
GAAAATATAATATCCGTGGAGCGTATGCTTACTTTTCTTTTCAAAAAGTTCACTCCCAGC
GTCTGTGTGTATTCCTTATCGTATATGTTCTGTACGTACTTCACCATCAGCGATGTTTTC
CCTACTTGTGCATCCCCTACTAATCCAACCTGAACTTCAACCTGATTTCGTACCGCAGGT
ATAGAATTGTTTGCTCCCGTGCTTGGTGTAGCCATCTTAGCTTAACTCAATTTAATTTCT
ACAGCAAAATCCAAACGTAATATCTATATTTTTCTCGAAAAACTGAGGACAAGAGCCAAT
CAATCATCTATAATCCAATTTATATTATTTTTTCCCTTCTGGGTTCTTTTCTTCCTTTTC
TTGTTTACCTTTTTTGCTTTTTCATAAAATAATTTCTCTAGATTTGAAGACAGCATTTTT
GTACATCCATACACCATACACCATACACCATAGCACCAGTACACTATATTTTTATGAATT
TTACTAAGAATTATTCCTGCAGGAGCTCCACTGAAAAAAAAAGAGCAGCATGGATGTCCG
GTAGAAGTGCTACTGAGTAAATGGGAAGGACGCGGTAGATCCAGTGTGGAATCAAGGTGG
TGCCGGTGTGAAGCCGCCTCGGCCGGCTGGACTCTCCAGGCCGGAGTGATGATTGCCACG
CTGAACGTAACACAGTTTCACAATACCAGTGTCCTCATTAGTGAGTTCCAATGTATAGTT
AGTAGTGGTATTTTGATATATGTGAGTGGTAGCAGATTTGAACTTAGTTAGTTGTATTCG
CCTTTGAGGAAACCAAGCAAAAAACCGATCTAGACTAATC
Chromosomal Coordinates Chr XIII from 146482-147249
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator