Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name OGG1
Systematic Name YML060W
Description Mitochondrial glycosylase/lyase that specifically excises 7,8-dihydro-8-oxoguanine residues located opposite cytosine or thymine residues in DNA, repairs oxidative damage to mitochondrial DNA, contributes to UVA resistance
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OGG1	6323580 upstream sequence, from -1000 to -1, size 1000
CTGTCATCTTGGTCATTCTGCAATTCAGTGAAGCTAGGTCTTTGCGTCAAAACAGCAATC
TTTTCTCCAAATTGCATTTTCTTCTTTTCGTTTTCATTTATCATTTCCAAACTTCTCTCT
TGAGATATAGAATTATTTTGAAGTTCATCAAAAGAACTTTCCTTTTTCAACGCTGGTCTT
AATGGATTCTTGAATCCTGTCGATCTCGATTTTTTTTGACTGCTCTGGTCAAATGAGTTT
TCAGAAATTAACTGCGGTGGTTGTATTATACTGGGTTTAAACATATCGTTCCAGGATAAA
GGACTGTCTTTATTGATAAAATTCATGACATTTTTATCCCTCATAGGCTTTTTGTCCACC
GGGTCTTCTTTATGTATGTCAGTGATAATTTTCTTTTCTTGCTTCTCAGTTTCTAACTGT
ATGCAATCAGGTTCTTCCCAATCATCCGAATCAGAGAGCAAATCTAGGTCTTCTTTTGAA
AGTATGGAAGGATGCTTCAATTGTGCTTGAATAAAGTTATTAGACCTGAAACCACGACTA
CTCATAGAAAACGATAGTTTGGCGTGCGATACGTTTTTGAGTAAAAGAAAACTGTTGAAA
CTACAGATAAATGGCCTTCTTGGTATAATATGATTCAATGTTGATCTTATCCACTTTGGC
ATGTAAAATTGATTGATACAAGTAAGCTAATCGCTCAATGGATAATATTACAAATAAAAA
TATCGAGGCAATACCAGTATTTCAATGTCTGGCCAAATAAATAGTTTAGTACAGCAATTT
GATTAACGTTAAAGTTACTCTCCTCTTTGAATAATGTCGTGGTTAAAAAGTAAAGTATTT
GTTTATACATTAAGTGAAGAAAATTAAGACGCGCCTTTCTTAATGTAACGCCAAAAATTT
TTAAGAGATGAGCTGAACAGCATCACAAAACTACTATTTCCAGCGGAAGAAGGCATTTGA
AGCGTCCTGATTCATAATTGCGATTTTATTTATCAACCAG
Chromosomal Coordinates Chr XIII from 151871-153001
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator