Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SUR7
Systematic Name YML052W
Description Plasma membrane protein that localizes to furrow-like invaginations (MCC patches); component of eisosomes; associated with endocytosis, along with Pil1p and Lsp1p; sporulation and plasma membrane sphingolipid content are altered in mutants
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SUR7	6323589 upstream sequence, from -1000 to -1, size 1000
ATATTTTTTTTATAATGAATATTATTGTAGGTTGCAGTATTATTGCTGTTATTATGATTA
TGGTTATTATTATTATTATTGTTGTTGTTGTTGTTGTTGATGATGATGTTGTTGTTGTTG
TTATTAAGATTAGCACACCCGGAACCGACCGAAAACTTTGTACTTACAGAATCTCGTTTT
GTTCTCTTCGATCTTTGGTAGAAAGTGTGTGTATCAAACTCGAAATGGTCATTTTTTCTT
TTATTCATGATCGTATCATTATTGGCGTCGCTGTTGTATGTAGTGGCGGCATTGCTACCG
GAATTGCAATTGTTTGTTTGGAACGCAGTATTGTGTTCATAGTATGAGAGCATTTCACGC
AGCACACTTGAGTCTTAAATTAATGAATAAAAGCAGCCAACCCCAAGAAAAAAGAGCCCT
TATCTGTTTCTGTCGCAGTCCTATTGTATTCTTCCTAACTATATAATTTTGTCAAAATGA
AAAATATAAAAAAAATAATAAAGTCAGCTGAGTGGTAAAGAGAAAGCAAAGGGAGAGAAA
AATCGGTTACCCAGATGGATTAGGTTACCCAGATGTCATACGTGTATCATGATTTCTAGA
AATTATTACCCTGTTTGGTACCATGACAACGGATATGGCAATCTTGCATTAAGTAAAATG
TCTCTAATGGGACCGTGAAGGTACAAAACAGCAATGGTCTAGGTAGTGGCATTCGAAGCT
TCGAAAGCGTGGCCTCGCCTCGAGCGTGAAGTCATATTTTCTCACTCTGCACTGCCGTGC
TGTGCCATGTAGCCCACTGTATGCCTCTAGCACCCCAATCGGGAAAATTGTAAACATTAG
CAGGTGTCGCCTCGAGGCCCCCGATACATTTTTCAACATCTCCTCGATACTTAAACAGCA
AACAAACAAGCAACACCCACGCAAGAAGATTTATTAATACCTCTTGACTCCCGTAGATAT
TGAAGAGACTAAGTATAGTAACGCATATCCGCACAATACT
Chromosomal Coordinates Chr XIII from 170402-171310
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator