Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ERG6
Systematic Name YML008C
Alias ISE1, LIS1, SED6, VID1
Description Delta(24)-sterol C-methyltransferase, converts zymosterol to fecosterol in the ergosterol biosynthetic pathway by methylating position C-24; localized to both lipid particles and mitochondrial outer membrane
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ERG6	6323635 upstream sequence, from -1000 to -1, size 1000
TGCTCGCTATCCTCGCCATCACGTGTACCAGTACGTCTATGTTCATTTTCTATTTCATCG
TGACGAGATTTTGAACCCTCAAACTCCGCTAATGAACCCGGAGAAACGACATCCAGCGAC
CTCTTGGCGGTAGACACACTCATGGTTTAAGAAACAACTTTTCCTTCTTTAAACGTTTTG
GGTGGCAAAAAACTTCCCTTAAACAAACTAAAAATGGCTCGTGTTCATGCACAAGTCAAC
CAGGGGCTCAGGAAAAAAAGCTAAACACCAATCCTATATATAACGTAAAGGTACTGTGCT
TAATCGGTAAACGGAAGACTATTAAGCAAATGTATCTCTTAAGACCTTACGCATCCATCA
GTTGCCACCCTCCTACTCTTCATCGGAGGGTTTCCGGTTCCCATGACAAAGACGGCGCTT
TGGCGGGGCCCAAATTGTTACCCGCACCCAGAAAAAGAAAAGAGTAACCTAGGTCAAATC
AACCAAACAGCTAGGGCTGGTTACTATTTTTGAAAAGATGCAACAGGGTAAGATCAGCAA
AATTTAGGGCCGAACAAAGCCCCGATCTTCGTATATGGTACCTCGTTCCCGTACTTATTT
TCAATTTTTGGCGTCGTTTACTGCCGTTTCCGATAAATACAAAAAAGTTTTCGAGAAGCG
AGAGTAAGTGAGGAGCAGACAATGTATTATTCACTGTAAACTGCTCCACTTCGTCTCAAT
GGTACACTTCATTTTTATCGCCTTACGAAGCATGCGTTTTATGCGAAGATTGGTGAGAAA
CCTCCAATACTTGCTGTTGCCGATAACTTCTTCATTGCTTTTTATATAGTTCGGGTGTTT
TCTCCTATCCTCTGCTGCTCTCTTTTTCTTTCCATTCGTCTTTGTAATTTATAAGCTGTT
AATTTTCATTCAAGTTTCCCTTATCTGTTTTACTTTCGATTTAAGTTTTACATAATTTAA
AAAAACAAGAATAAAATAATAATATAGTAGGCAGCATAAG
Chromosomal Coordinates Chr XIII from 252990-251839
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator