Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name YPT7
Systematic Name YML001W
Alias AST4, VAM4
Description Rab family GTPase; GTP-binding protein of the rab family; required for homotypic fusion event in vacuole inheritance, for endosome-endosome fusion, similar to mammalian Rab7
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YPT7	6323642 upstream sequence, from -1000 to -1, size 1000
TCTTAATATTTATTAATTTGAAATCCGATGATTTCGAGGATGCTTATAAGGGTCTTAACG
AAATGGGTAGAAAATTAATTAATAGTGAAGCATCCAGCGCATTTAAGGGGATTATAACAA
ATCATAATATGTTCAGTGAATTATCGCTAGCAGCACTACTAGAAAACGTGCGTTTCTTGG
AACAATGTACTATCCAACTATCTAGTTTCGTTCAGATAATTTTATTTGAAAAAATTCCGA
ACTGGTGGAAACATTATGGTGAGTTTTTAGCTTTACATAAAAGCTATCGGAAGGCTTTTC
CTAACATGGTTAAGCCAAAAAGTGCATCAGATACCTCTAGTCGTGCTCCACTTGGTGGTT
TTATTGAAACGAAGCGTGAACAATCGGAGCAAAGACTAGCGGTTCAGATAAAGGCCTCTT
CAAAAATGCTCAAAGAACTTGGAAGCGAAATTTTTGTAGCTCACGAAAGGTTGGCCGAGG
AACTAAGCAATTATATGGAGTTCAGGAAGGCGTGCTTAGATCAGCGTAGTCTTGTGGCAT
TTGCCACAACCAACATTAGCGTTCTTCAAGAATGTGTTTAAGATTGACTGAGCATTGCAA
TATTTTACCTTCTTCTCACTTGTTCTATAGAATTTTTTACCCAAAAATAAGAGATAAAGA
GTTTGAAAGAAACATCATTACATATATATATATATACGGGCAGCTCCGTAACTCGAAAAG
AGTGACAGCTGTTTTACTCTGTAATAGCTGACGATTCTTCAGTGATTGGAATAACCTCAG
AACTCACCGGTACGGGTAACGTTTGTATCTCGCGGATTAACTTTTCGCATTTCGACCTAC
TGAGAGAAGAAGTTCCTTTTGTTAATCTGTACCTTTATCTTGAAAGCAGTCGTTACAGAG
GAACAGCATTGGGAATCACCAACAAAATAAGAGGAATAAGCTCATCCAGTCCACTTCTTA
TCCATATAGAAACCCCTTCTGTATCAATTCAAATTAAGTG
Chromosomal Coordinates Chr XIII from 267174-267800
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator