Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SIR3
Systematic Name YLR442C
Alias CMT1, MAR2, STE8
Description Silencing protein that interacts with Sir2p and Sir4p, and histone H3 and H4 tails, to establish a transcriptionally silent chromatin state; required for spreading of silenced chromatin; recruited to chromatin through interaction with Rap1p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SIR3	6323475 upstream sequence, from -1000 to -1, size 1000
GAGTAAATGTAACACGTTGGCCTTTTTATGTTTTAAACTCCTCATGTAGGTCGTGTATGC
AGAACTTTCTGCCTGTTGTGAACCGATTTTGTTGTATGCATAATCTAAAATGATATCTAA
ACCCAAGCTTTCTAAAACCTCACGATAATCAAAAAGATAGTCCGTTCCTATGCTACTGCA
GGTACTCTTAGTAGTCGAATTCTTTACGCTATGCATATTTCCTTCAGAGTCGAATACTTC
CACCATGGTATATGTTGAATCGCACCTCCCATAAAGCGACACTGTGATGTACTGAGGAAC
ATTCTTTATCTGACTTTCGGTGTAAGCAGTCAATATATACAGTTCGGATGTTGTTAAGCC
TACACCGTTATTTTCTTCTGTAGATGTCGACTGCTCCATAGACTCTCTCAACACGGTAAA
TAAACCCGTCGTAATATCAGCAGAGTAAGTATCCAGTCGTGACATGTACAATGTTCTTGG
CGAAGAAAGGGGTCCGACAGTCAACGCCAACCCGAAAGAGATTATGAGTAATGTCGTCCC
TAATCTTAGCCACTGTACCACTTTCTCAAGGGCTGTAAGGTTCTGGAATGGCCTGGCTAT
TGTATCTCGTATTCTTGACATCACCATTTATTTTCGATCCATTAGATATGCAAGGGTATT
CGCAATGACTGATACACAAAGAAATGGTGTAAATGAAACTAAGTAGAGAGTTGACAGTGT
TAAGCAAACAACGAATCCAGGGGAACAAAGTATTCGGGACGTTTGTTTATGCGGCGTCCA
AAAGATGTATTTAAAGTTAACCATATTATGTATCAATCTAAATAAAGAAATAATTGTAAA
TTTTCATCGCATCAGTAATATGACCGCGAAAACGCTATTCTTTCCAAAAAAGTTAAAATG
AACATAGTATGAAAAAGAAAAACACATAAGCAGCCCTTTCATCACCTTCCTTACAGGGGT
TTAAGAAAGTTGTTTTGTTCTAACAATTGGATTAGCTAAA
Chromosomal Coordinates Chr XII from 1022251-1019315
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator