Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SFP1
Systematic Name YLR403W
Alias [ISP(+)], [ISP+]
Description Transcription factor that controls expression of ribosome biogenesis genes in response to nutrients and stress, regulates G2/M transitions during mitotic cell cycle and DNA-damage response, modulates cell size; regulated by TORC1 and Mrs6p; can form the [ISP+] prion
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SFP1	6323435 upstream sequence, from -1000 to -1, size 1000
AAACTTTTCAAAAATGGTGCACGGGCTTTCTGTATATTGAACTTTCCGTCGCTTTTCGGA
GCTACAATTCCCCTACCCGGCTTGTCGGCATTAAGTCTCTTCATCCCGTGTACTATTACC
CGACAGTTTCTGCGGCATGTTCTGTGGAACGACGGTACGGGCGGTGACTGGGTGCCAAAC
AGTGCGGCGTTCCCGTGCGCAAGGTGGTCTGCGGTAGGAAAAAGAAACAAAACGCGCCTA
CGTCGTGCAAGGGGACAGGATTTTGTCAGTTACATAATAAGGAGCAATTTCGAATCAATT
GAAATTTGGAACAAATGGGCGATGCATTCGTTAAAAGGCGATTTTGTATCAAATAACGTC
ACTATCAGCCATTGTCACTTGCCACTGTCGCCTGCCACCGCTATTGCCATTATCATTTGC
TTTCGCATCGTCACCGATTTAAAGCTCTCTAGGCTAACGTACGCATTTTACCTCCCAGGC
CCTATCTCTTTTCTACCTGTCATCCCTATATAACGTCTTGTACATTCTAGTGGCTCCGTT
AACAAGGTTTGACAAATATTACAATCAAAGAAGGATAGCGCTAGTCAATCTAATCATTAA
GTTCGCTTATAAAGAGAAGGAAAGCTAGATTTTTTTTCTACTTCAATTACATATCGGTGC
TTCTCTCTGGTGGTTTTCTGTTTTTCTAATATTGATCGATTTTACGGTGAGTTAAACTAC
TTCCTTTTATCGCAATATCATATTTAGAGCGAGAAAGCAAGAAGAATAAAGCTAGGAGAA
AAAAGCGCCACGATACATTCATACTAAGTTTATAATATACCGGTCGTCTTTTGGCTTTCT
GATACCATATTATATCCTCGAAACACTTTCTCTGGATTCACCTACTATTAATCACCTCAA
GATTTCACTTGTAAGGCGTTTTCAAATTTATTGTTATTAAAAGACATATTCATATTCAGT
ATTTTTATTTTTCTTCGAAACAGGAAAAGCTTATCTGAGT
Chromosomal Coordinates Chr XII from 925568-927619
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator