Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BDF1
Systematic Name YLR399C
Description Protein involved in transcription initiation at TATA-containing promoters; associates with the basal transcription factor TFIID; contains two bromodomains; corresponds to the C-terminal region of mammalian TAF1; redundant with Bdf2p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BDF1	6323431 upstream sequence, from -1000 to -1, size 1000
ACTGGTGTGGAAGAGACGAACTTGAAACTCTAATGGGTAGTACGGATGTTAATGATTGGA
TCAAGCTAAGTGATCTATTTTTCGGTAAAACCGACGAGAACTTTGTATTTGTCCCCAAAC
ATAAGAGCAGCTCTTATGCAAACAGAGATTCCTAAATAGAAAATCAAGTGTACATGTATC
ATAAATCATATCTGATGGGTAAGCGCGGTTATTTTTCCTTTGCAAGACGAGAATTGGAAT
ATGTACGGGTGTCAATTTCAAACGTGAGGTATGGGTTCCAAGAAAATCAAAATAAGCACA
GCTGGGAAGGGTTAGGTAGGAGCGGAGAAAAGTGTATTGAGAAAATCTTAACGAGTTCGG
ACAGGTTATCATCGCAACACAAATGAACATAACTATCAACCTGATGCAACTGTACCTGAG
TGGCTCAAATAGCAGGTAAATACAGGTGGATTTAGAAAACGCGCAGTGATTTGAATCTCG
CAAGTCGCCTCTGAAAAAAGGCATTTCGCAAACTGGGGTGTCTGGAAAGTTCATTACATC
CCGTTCACATAGCTCCTTCCTGGTACTTGAGTAAGTCTTTTAAAACAATTCAACATCTAC
TTTGTATCAGGCGCTTGGATTTACACTTTTGGCATATTTATTCCTACGCTGCAGTTGCTA
TTAGCCGCGGAAAGGAAGTACAATAACGTTTTACGTCGATTCGTGTTTGTATTACCCAGC
ACCTTTTTCTTCTTGAAGATGTATGCACCCGTGCCCCCGCTGTAGTAGCCCCGCGCACTT
TGTGTGTGCAGCAACTTCAGGCTTGCTCCGTGAACTCACAACGTCGGCCGTCGTCGCTTG
TCGCGCGTCGTCGCGAAGTATTTAAACAAAGCGGGTTTTTCTTGTCCCTTAATTAAGCCT
ACTGGGTCGCTCCTTCCCAAATAATTTGATTTTTTCTCCCTTGCCACAGTAAACAAGCTA
AAAGGCGGTCGAATCTCAACGGCTCTGATAAACGTACGTA
Chromosomal Coordinates Chr XII from 921596-919536
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator