Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SKI2
Systematic Name YLR398C
Description Ski complex component and putative RNA helicase, mediates 3'-5' RNA degradation by the cytoplasmic exosome; null mutants have superkiller phenotype of increased viral dsRNAs and are synthetic lethal with mutations in 5'-3' mRNA decay
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SKI2	6323430 upstream sequence, from -1000 to -1, size 1000
AGTAGTGACATATGATATGAAACGTATCATTACAGAGAGGATCAATGATTTACCAACTTC
CAAATTAGAAAGAGCAATCGACATAATAAAAAAATCCATGCCCAATATTTCTGAAGACGA
TGAAGTAGAACTTGACCTCGACACTTTAGATAATCACACCATCTTAACATTGTACAACAC
TTTCTTTAGACAATATGAAAGCTCATCCGGTGCTTCTAACGGTTTGGACGGTACTTCAGG
TGTTACGCGAGATGCTTCGTCCTTGTCGCCTACAAGTGCGGGAAGCAGAAAGAGAAGATC
TAAGGCATTAAGCCAAGAGGAGCAGAGTAGGCAGATAGAAAAGATAAAAAATAAACTAGC
TATCTTAGACAGTGCTTCACCTCTGAGCCAAAACGGCTCCCCAGGCCAAATTCAAAGCGC
TGCACACAACGGGTTTTCCTCATCTTCAGATGACGATGTTAGCAGCGAAAGTGAAGAAGA
GTGACTGAATTTTGAATTTGATTATCTTCAACGACTGAGAAGAATGAGCACCATTTTGAT
ATTTTGATTAATTAAGTGGTAATCTTAAGCTCATATACAAAAAGGGAAGGAAAAAAAATA
AAGATAGAAAAGATCTTAGGAACGGATAGAGGTTTGAAAAAGGAATAACAGGTAATTTTT
CATTTTCATATCGGTTGTAACATTATAAAGCTCACAAATTTAAAACAAAAAAAAACATAA
ACCTAACAAGGTTAATCATTTGCACATGATCTCATCATATAGATCAATTCATAATCTATA
TAATAATGAATAATTAGAATAAAAATTTCCTCTTGTCTCAGAACGCCCATCGGATGGCAT
AACTTTAGTTAATGATATCACGACGGACGAAGTATTGAAAGACAACCTAACCTGTTCATC
AATTTAAAAGTCAACGCAGAAACTATAATACATTGCCACATAGTTCTTTCCGATATGAAC
AACCTAACTCACAAAATTTACTGTACTAATACTAATTTAT
Chromosomal Coordinates Chr XII from 919019-915156
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator