Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name COX8
Systematic Name YLR395C
Description Subunit VIII of cytochrome c oxidase, which is the terminal member of the mitochondrial inner membrane electron transport chain
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>COX8	6323427 upstream sequence, from -1000 to -1, size 1000
CTCTTTGTAAAAATTCACTTCGAGAAAAGGATTATGAATATCTAAGAACCTTTATGATCG
ACTCTTGGGGCATTGAAAAATGCTTTCAACTTGAATCATTGGCTGAGTTAGGATTTTTCA
CTAGCAAAACGGGAAAAACTGATTTGCATATTACAACAAGTAAGTCAACAAGATTACAGA
AAGAATACCGTTATATTTCACAATGGTTCAATACAGTACCCATAGAAGACGAGCATGCTG
CCGATAAAATCACAAATGAGAACGATGACTTCTCGGAAGCCACTTTTGCTTACAGTGGTG
TAGTGCCCTTGACAATGAGACTGGTTCAGATGTTATATGATAGGTCTATCTTGTTCCATA
ATTATTCCTCGCAGCAGCCTTTTATACTGTCAAGAGAACCTAGAGTTTCTCAAACGGAGG
ATTTAATTGAACAGTTATATGGAGACTCACATGCGATCGAAGAGAGTATATGGGTCCCGG
GAACCATTACAAAAAAGATCAATGCAAGCATCAAGAGCAATAATAGACGGTCCATAGACG
GATCTAATGGGACATTTCATGCTGCAGAGGATATTGCACTCGTAGTATTCCTCGGAGGTG
TAACAATGGGTGAAATAGCTATAATGAAGCATTTGCAAAAAATACTAGGTAAAAAAGGTA
TCAATAAAAGGTTTATCATCATCGCCGATGGCTTGATCAATGGCACAAGGATCATGAACT
CTATATCTTAATTATTATATGATAGATTTGTTAATTTTTTGTATATGCAAATGTGCTTTT
TTTCACCAAACGGTTTGCACCAATCATACGAGAGAAGTGTTCGGTGTTTACGGAAAAGCT
AGGGGACTAAGAAAAATTGAAAATAAAGGCTGACAGCAGTAGAAACCATTGTGCTGGCTT
AGTGATTTATAAGAATGGTTAATTAGTTTTGTATCCTTTAATTTTCTAGATAGAGCCACA
GAGCAAACTAAACAGAAAAGTTATCCATTTCCATTACGCA
Chromosomal Coordinates Chr XII from 909965-909729
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator