Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TAL1
Systematic Name YLR354C
Description Transaldolase, enzyme in the non-oxidative pentose phosphate pathway; converts sedoheptulose 7-phosphate and glyceraldehyde 3-phosphate to erythrose 4-phosphate and fructose 6-phosphate
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TAL1	6323386 upstream sequence, from -1000 to -1, size 1000
TCTATACCCATTGATCGGTAAGTACGGTATGGATTACATGTACGATGCTTGTTCCACCAC
CGCCAGAAGAGGTGCTTTGGACTGGTACCCAATCTTCAAGAATGCTTTGAAGCCTGTTTT
CCAAGACTTGTACGAATCTACCAAGAACGGTACCGAAACCAAGAGATCTTTGGAATTCAA
CTCTCAACCTGACTACAGAGAAAAGCTAGAAAAGGAATTAGACACCATCAGAAACATGGA
AATCTGGAAGGTTGGTAAGGAAGTCAGAAAGTTGAGACCAGAAAACCAATAAAGAGGAAA
ATAATATCAAGTGCTGGAAACTTTTTCTCTTGGAATTTTTGCAACATCAAGTCATAGTCA
ATTGAATTGACCCAATTTCACATTTAAGATTTTTTTTTTTTCATCCGACATACATCTGTA
CACTAGGAAGCCCTGTTTTTCTGAAGCAGCTTCAAATATATATATTTTTTACATATTTAT
TATGATTCAATGAACAATCTAATTAAATCGAAAACAAGAACCGAAACGCGAATAAATAAT
TTATTTAGATGGTGACAAGTGTATAAGTCCTCATCGGGACAGCTACGATTTCTCTTTCGG
TTTTGGCTGAGCTACTGGTTGCTGTGACGCAGCGGCATTAGCGCGGCGTTATGAGCTACC
CTCGTGGCCTGAAAGATGGCGGGAATAAAGCGGAACTAAAAATTACTGACTGAGCCATAT
TGAGGTCAATTTGTCAACTCGTCAAGTCACGTTTGGTGGACGGCCCCTTTCCAACGAATC
GTATATACTAACATGCGCGCGCTTCCTATATACACATATACATATATATATATATATATA
TGTGTGCGTGTATGTGTACACCTGTATTTAATTTCCTTACTCGCGGGTTTTTCTTTTTTC
TCAATTCTTGGCTTCCTCTTTCTCGAGTATATAATTTTTCAGGTAAAATTTAGTACGATA
GTAAAATACTTCTCGAACTCGTCACATATACGTGTACATA
Chromosomal Coordinates Chr XII from 837357-836350
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator