Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPS25b
Systematic Name YLR333C
Description Protein component of the small (40S) ribosomal subunit; nearly identical to Rps25Ap and has similarity to rat S25 ribosomal protein
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS25B	6323365 upstream sequence, from -1000 to -1, size 1000
CAATCCTCGCATTTCAGCTTCCATTATATTTGATGACTGTTTCTCAATCTTTATGTTATC
TTCTTACACCGTATGTGATGATATACTAATAACACGGATACTTAATAAACAGATGATGTT
ACAGTTTCATCCAATACGAACGATTATCAAATTATTGCAACATTTCCCAGTGAAATCTTC
ACCAAATGCTCATACAGCGTGACAATAATGAGCATTTTGAATTTTAAGGAAATTAATTTG
TCTTCTATCTTTTGCATCCGTGCCTCCTGGATAATAACTTCAATCCTTGCACCACCATTG
AACTTGTAACAGAGCTTTTTTTTTAACTTCTTGTCCTGGTACTGCATAATGAATAGCGCC
AGAAGTTTCACGGATGTGCTACTGTTGGGAAGAGCCGCGAGTATGGAACTTCCTAAGCAT
CGCAAGTCAGGGGCCAGATGGGTAACCGGCAAAGACTAATTAGTATTGATGAAGTTACTT
ACCAATATATGTCATGAGAAGTGGCTTGTAAAATTTATTATTACAGTCACTCAGACAGAG
CACTAAACTGAACTAGTTATTAAGGTATGTGCAGTTGATTCACGGGAAGAAGATATTTGA
AAGAACCGAACCGATGCCAAAATCAAAGCCAAATCTGGGATTTGCCAAAAAAATTTTAGG
ATATAGAATAAAGATACGAAATATGAAAGGCGAGGAAAATTAGAATTAGTGGAGCAAATA
ATGAGCACAGGTCGCTAAGATCATTGTAACTCAGAATGACGTCAATCATAACTGGGTAAT
GAGATGTGCTATTGTATCTACTAAATCTATTAAACAGATCTTTATCATTCCAAGACCACC
ATACAGTTTAGTCTGCAGGCCATTTTGCTTTTGCTTTGACTTTTTTTTCTGAAAGATTCA
TTCATCAAAGGAACTAGAATATCTCTGCGTATTTTGTAATATAATTTTTGACACTAACAT
CAATTTTCACCCTTTCTTACGTCTCAGAACATAATATAAC
Chromosomal Coordinates Chr XII from 795899-795573
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator