Yeastract IST IBB-BSRG INESC-ID
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPS25b
Systematic Name YLR333C
Alias eS25, rp45, S25B, S25e, S31B, YS23
Description Protein component of the small (40S) ribosomal subunit; nearly identical to Rps25Ap and has similarity to rat S25 ribosomal protein
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS25B	6323365 upstream sequence, from -1000 to -1, size 1000
CAATCCTCGCATTTCAGCTTCCATTATATTTGATGACTGTTTCTCAATCTTTATGTTATC
TTCTTACACCGTATGTGATGATATACTAATAACACGGATACTTAATAAACAGATGATGTT
ACAGTTTCATCCAATACGAACGATTATCAAATTATTGCAACATTTCCCAGTGAAATCTTC
ACCAAATGCTCATACAGCGTGACAATAATGAGCATTTTGAATTTTAAGGAAATTAATTTG
TCTTCTATCTTTTGCATCCGTGCCTCCTGGATAATAACTTCAATCCTTGCACCACCATTG
AACTTGTAACAGAGCTTTTTTTTTAACTTCTTGTCCTGGTACTGCATAATGAATAGCGCC
AGAAGTTTCACGGATGTGCTACTGTTGGGAAGAGCCGCGAGTATGGAACTTCCTAAGCAT
CGCAAGTCAGGGGCCAGATGGGTAACCGGCAAAGACTAATTAGTATTGATGAAGTTACTT
ACCAATATATGTCATGAGAAGTGGCTTGTAAAATTTATTATTACAGTCACTCAGACAGAG
CACTAAACTGAACTAGTTATTAAGGTATGTGCAGTTGATTCACGGGAAGAAGATATTTGA
AAGAACCGAACCGATGCCAAAATCAAAGCCAAATCTGGGATTTGCCAAAAAAATTTTAGG
ATATAGAATAAAGATACGAAATATGAAAGGCGAGGAAAATTAGAATTAGTGGAGCAAATA
ATGAGCACAGGTCGCTAAGATCATTGTAACTCAGAATGACGTCAATCATAACTGGGTAAT
GAGATGTGCTATTGTATCTACTAAATCTATTAAACAGATCTTTATCATTCCAAGACCACC
ATACAGTTTAGTCTGCAGGCCATTTTGCTTTTGCTTTGACTTTTTTTTCTGAAAGATTCA
TTCATCAAAGGAACTAGAATATCTCTGCGTATTTTGTAATATAATTTTTGACACTAACAT
CAATTTTCACCCTTTCTTACGTCTCAGAACATAATATAAC
Chromosomal Coordinates Chr XII from 795899-795573
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator